header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7787
Transcript Name: atp2a2a-201
Previous Name: atp2a2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025011 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025011|OTTDARG00000020112|ZDB-GENE-040426-702 atp2a2a|OTTDARP00000020594 atp2a2a-001 LG_ CR407563.8 Danio rerio protein_coding KNOWN, 3724 bp
ACCAGTGAACGGACGAGAAGGACGGCGAAAGGGGTCGAGC
GTCACATTTCCAGGCAGGCAGAGGCTTGGACGGGGCTGAT
TGTGATGTACTAAGCAAGGAGCTTTTCTTTGGCGTTCACT
GACACACATTTCTTTGGGGCACAAGAAGAAGACTGTTTGG
ATAAGACTCCTGGAAGATTTCTTGACTTGAGCGGGATTCT
CTTCCCATCTAACCATGGAGAACGCTCACACCAAGAGTGT
GGAAGAAGTTTATAGTAATTTCAGCGTCAACGAGAGCACG
GGACTGACTTTAGACCAGGTGAAAAGGAATAGAGACAAAT
GGGGTCCTAACGAGTTGCCTGCAGAGGAAGGAAAGTCAAT
ATGGGAGCTTGTCATTGAGCAGTTTGAAGATTTACTTGTG
CGGATTCTTCTACTGGCAGCTTGCATATCTTTTGTATTAG
CCTGGTTCGAGGAGGGGGAGGAAACTATCACTGCCTTTGT
GGAGCCTTTTGTAATCTTACTGATTCTTATAGCTAATGCC
ATCGTCGGCGTTTGGCAGGAACGTAATGCAGAAAATGCCA
TTGAAGCCCTCAAAGAGTACGAGCCAGAGATGGGCAAGGT
GTACCGTCAGGACAGGAAGTCCGTGCAAAGGATCAAAGCC
AAAGACATCGTGCCTGGAGACATAGTGGAGGTCGCTGTGG
GTGATAAGGTGCCTGCCGATATCCGTATCAGTGCCATCAA
GTCCACCACACTCCGAGTGGACCAGTCTATTCTGACAGGC
GAGTCTGTATCTGTCATCAAGCATACTGACCCCGTGCCGG
ATCCCCGTGCCGTCAATCAGGACAAGAAGAACATGTTGTT
CTCAGGAACCAACATTGCTGCAGGTAAAGCCATCGGCGTA
GTGGTGGCCACAGGTGTGAACACAGAGATCGGTAAGATCC
GTGATGAAATGGCCTCCACCGAGCAGGAGAGGACGCCGCT
GCAGCAGAAGCTGGACGAGTTTGGCGAGCAGCTCTCTAAA
GTCATCTCCCTGATCTGCATCGCCGTCTGGATCATCAACA
TCGGCCACTTCAACGACCCCGTCCACGGTGGCTCCTGGAT
CCGTGGCGCCGTTTACTACTTCAAGATCGCCGTGGCTCTG
GCTGTAGCTGCCATTCCTGAAGGTCTGCCCGCTGTCATCA
CCACCTGCCTGGCTCTCGGCACTCGCCGTATGGCCAAGAA
GAACGCCATCGTCCGCTCTCTGCCCTCTGTGGAGACTCTG
GGCTGCACCTCAGTCATCTGCTCCGACAAGACTGGCACCC
TCACCACCAACCAGATGTCCGTCTGCAGGATGTTCATCAT
AGACAAGGCTGAAGGAGAAAACTGCTCACTGACTGAATTC
ACCATCTCTGGCTCCACATATGCTCCTGAAGGAGACGTAT
GCCTTGACAACAGAATCGTGAAGTGCTCCCAATATGATGG
TTTGGTGGAGTTGGCGACCATCTGTGCCTTGTGCAATGAC
TCCTCCCTGGATTTTAATGAGTCCAAAGGTGTTTATGAGA
AGGTTGGAGAGGCGACAGAAACGGCTCTAACCTGCCTGGT
GGAAAAGATGAACGTCTTTGACACTGACGTCAGGAACCTG
TCAAAGATCGAGCGAGCCAATGCCTGCAATGCTGTGATCA
AGCAGCTGATGAAGAAGGAGTTCACCCTCGAGTTCTCCAG
AGACAGAAAGTCCATGTCTGTGTACTGCTCCCCAAACAAA
GCCAAATCCTCCTCTTCTAAGATGTTTGTCAAGGGAGCTC
CAGAAGGGGTGATCGATAGGTGTGCATATGTCCGTGTTGG
AGGATCCAAGGTTCCTCTGACTCAGGGCATCAAGGACAAG
ATCATGTCTGTGATCCGCGAGTACGGGACTGGCCGGGATA
CCCTGCGCTGCCTGGCACTGGCCACCCGTGACAATCCGCT
CAAGAAAGAGGAGATGGTCCTGTCAGATACCGCCCGGTTT
GCTGATTATGAGTCTGATCTAACCTTCGTGGGCTGTGTGG
GCATGCTGGACCCTCCTCGAACAGAAGTAGCGGCCTCCAT
CAAGCTCTGCCGCCATGCTGGGATCAGGGTCATCATGATC
ACCGGTGATAACAAAGGCACGGCCGTGGCCATCTGCAGAC
GCATCGGCATCTTCTCTGACGAGGACGACGTCCACCGCAT
GGCTTTCACGGGACGCGAGTTTGACGACCTGTCGCCCCAT
GCCCAGCGTGAGGCGGTCACTGTGGCCCGCTGCTTCGCAC
GAGTCGAGCCTTCACACAAGTCCAAGATTGTGGAGTTCCT
GCAGGGCTTTGATGAGATCACTGCCATGACAGGAGATGGT
GTGAATGATGCCCCTGCCCTGAAAAAGGCAGAGATTGGCA
TCGCCATGGGCTCTGGCACTGCTGTGGCCAAGACAGCCTC
GGAGATGGTCCTCGCTGATGACAACTTTTCCACCATTGTG
GCCGCCGTTGAAGAAGGCAGAGCAATCTACAACAACATGA
AGCAGTTCATCCGCTACCTGATCTCCTCCAACGTGGGAGA
GGTCGTCTGTATCTTCCTGACCGCTGCATTGGGTTTCCCT
GAGGCGCTGATCCCCGTCCAGCTGCTGTGGGTGAACCTGG
TGACTGACGGCTTGCCTGCCACCGCTCTAGGCTTCAACCC
CCCTGATCTGGACATCATGAACAAGCCCCCCCGAAGCGCC
AAAGAGCCCCTCATCTCCGGATGGCTCTTTTTCAGATACT
TGGCCATCGGCTGTTATGTGGGTGCTGCTACTGTAGGAGC
TGCAGCCTGGTGGTTCATTGTTGCTGATGATGGTCCAATG
ATCACACTTTACCAGCTGAGTCATTTCCTGCAGTGTTCTC
CCGATAATCCTGACTTCCAGGACTTGGAGTGTCACGTCTT
CGAGTCTCCTTACCCCATGACCATGGCCCTGTCTGTGCTC
GTCACCATTGAGATGTGCAACGCCCTCAACAGTCTATCCG
AGAACCAGTCTCTGGTGCGCATGCCACCCTGGGAGAATAT
CTGGCTGCTGGGAGCCATCTGTCTCTCCATGTCTCTGCAC
TTCCTCATCCTCTATGTGGAGCCACTGCCGGTCATCTTCC
AGATCACTCCTCTGAATGTGACGCAGTGGATGATGGTGCT
GAAGATCTCGCTGCCTGTCATTCTCTTGGACGAGCTGCTC
AAATTTGTGGCGAGGACCTACCTGGAGCCTGCTCCAGAGG
ATTAAGCCCATCTACTCTCTGTATTCCATGCAGAAGCTTT
TCTTGACTTTAGTGCATGTATGTTGTTTCAAGCAGCTCCA
CACATCAGTCTAGGCCTGCATGTCCAAACAAAAAAAACCT
GAATAATTTGCATCGTTAGTTTAGAAGAAGCTCAAACATT
AGGAGCGACAAATAAAGCTGAACATTGAAATTTGGAAATA
CTCTTGAAATGTGACATTAAAGCAGATTTGATGATGCATG
TCCCCCCTAATGTTAAACTTTTGTATAGGAACTATTTAAT
TTGAAAAAAATATTGAACCTTTTGTGAAATATGTAAATTA
ACCAAAAAAAAACCTGATAGTTTATGTTGCTGTTTTGCGC
AGGGATGTGCAATATGTTTTAAAGCCGAGGCTCATTTCAG
GTGTGTGTTTGTGTGTGTGAGAGACATTGAGAAACAGGCC
GTCTTTTACAGCCGGAGCTGCCAGATCAGTGTTGTAATTA
TCACAATCAATTGTGGTTCATTAATAAAAAGATATTACAT
GGTC

atp2a2a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript atp2a2a-202 (1)    Ensembl 798
mRNA atp2a2a-201 3724
atp2a2a-203 (1)    Ensembl 3186
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp2a2a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025011 (1),  Ensembl_Trans:ENSDART00000042040 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC045327 (1) 3738 bp
GenBank:AW279702 (1) 438 bp
CITATIONS (2)