Transcript

atp2a2a-203

ID
ZDB-TSCRIPT-090929-15962
Name
atp2a2a-203
Previous Names
  • atp2a2a-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035309 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035309|OTTDARG00000020112|ZDB-GENE-040426-702 atp2a2a|OTTDARP00000028383 atp2a2a-003 LG_ CR407563.8 Danio rerio protein_coding KNOWN, 3186 bp
ATGGAGAACGCTCACACCAAGAGTGTGGAAGAAGTTTATA
GTAATTTCAGCGTCAACGAGAGCACGGGACTGACTTTAGA
CCAGGTGAAAAGGAATAGAGACAAATGGGGTCCTAACGAG
TTGCCTGCAGAGGAAGGAAAGTCAATATGGGAGCTTGTCA
TTGAGCAGTTTGAAGATTTACTTGTGCGGATTCTTCTACT
GGCAGCTTGCATATCTTTTGTATTAGCCTGGTTCGAGGAG
GGGGAGGAAACTATCACTGCCTTTGTGGAGCCTTTTGTAA
TCTTACTGATTCTTATAGCTAATGCCATCGTCGGCGTTTG
GCAGGAACGTAATGCAGAAAATGCCATTGAAGCCCTCAAA
GAGTACGAGCCAGAGATGGGCAAGGTGTACCGTCAGGACA
GGAAGTCCGTGCAAAGGATCAAAGCCAAAGACATCGTGCC
TGGAGACATAGTGGAGGTCGCTGTGGGTGATAAGGTGCCT
GCCGATATCCGTATCAGTGCCATCAAGTCCACCACACTCC
GAGTGGACCAGTCTATTCTGACAGGCGAGTCTGTATCTGT
CATCAAGCATACTGACCCCGTGCCGGATCCCCGTGCCGTC
AATCAGGACAAGAAGAACATGTTGTTCTCAGGAACCAACA
TTGCTGCAGGTAAAGCCATCGGCGTAGTGGTGGCCACAGG
TGTGAACACAGAGATCGGTAAGATCCGTGATGAAATGGCC
TCCACCGAGCAGGAGAGGACGCCGCTGCAGCAGAAGCTGG
ACGAGTTTGGCGAGCAGCTCTCTAAAGTCATCTCCCTGAT
CTGCATCGCCGTCTGGATCATCAACATCGGCCACTTCAAC
GACCCCGTCCACGGTGGCTCCTGGATCCGTGGCGCCGTTT
ACTACTTCAAGATCGCCGTGGCTCTGGCTGTAGCTGCCAT
TCCTGAAGGTCTGCCCGCTGTCATCACCACCTGCCTGGCT
CTCGGCACTCGCCGTATGGCCAAGAAGAACGCCATCGTCC
GCTCTCTGCCCTCTGTGGAGACTCTGGGCTGCACCTCAGT
CATCTGCTCCGACAAGACTGGCACCCTCACCACCAACCAG
ATGTCCGTCTGCAGGATGTTCATCATAGACAAGGCTGAAG
GAGAAAACTGCTCACTGACTGAATTCACCATCTCTGGCTC
CACATATGCTCCTGAAGGAGACGTATGCCTTGACAACAGA
ATCGTGAAGTGCTCCCAATATGATGGTTTGGTGGAGTTGG
CGACCATCTGTGCCTTGTGCAATGACTCCTCCCTGGATTT
TAATGAGTCCAAAGGTGTTTATGAGAAGGTTGGAGAGGCG
ACAGAAACGGCTCTAACCTGCCTGGTGGAAAAGATGAACG
TCTTTGACACTGACGTCAGGAACCTGTCAAAGATCGAGCG
AGCCAATGCCTGCAATGCTGTGATCAAGCAGCTGATGAAG
AAGGAGTTCACCCTCGAGTTCTCCAGAGACAGAAAGTCCA
TGTCTGTGTACTGCTCCCCAAACAAAGCCAAATCCTCCTC
TTCTAAGATGTTTGTCAAGGGAGCTCCAGAAGGGGTGATC
GATAGGTGTGCATATGTCCGTGTTGGAGGATCCAAGGTTC
CTCTGACTCAGGGCATCAAGGACAAGATCATGTCTGTGAT
CCGCGAGTACGGGACTGGCCGGGATACCCTGCGCTGCCTG
GCACTGGCCACCCGTGACAATCCGCTCAAGAAAGAGGAGA
TGGTCCTGTCAGATACCGCCCGGTTTGCTGATTATGAGTC
TGATCTAACCTTCGTGGGCTGTGTGGGCATGCTGGACCCT
CCTCGAACAGAAGTAGCGGCCTCCATCAAGCTCTGCCGCC
ATGCTGGGATCAGGGTCATCATGATCACCGGTGATAACAA
AGGCACGGCCGTGGCCATCTGCAGACGCATCGGCATCTTC
TCTGACGAGGACGACGTCCACCGCATGGCTTTCACGGGAC
GCGAGTTTGACGACCTGTCGCCCCATGCCCAGCGTGAGGC
GGTCACTGTGGCCCGCTGCTTCGCACGAGTCGAGCCTTCA
CACAAGTCCAAGATTGTGGAGTTCCTGCAGGGCTTTGATG
AGATCACTGCCATGACAGGAGATGGTGTGAATGATGCCCC
TGCCCTGAAAAAGGCAGAGATTGGCATCGCCATGGGCTCT
GGCACTGCTGTGGCCAAGACAGCCTCGGAGATGGTCCTCG
CTGATGACAACTTTTCCACCATTGTGGCCGCCGTTGAAGA
AGGCAGAGCAATCTACAACAACATGAAGCAGTTCATCCGC
TACCTGATCTCCTCCAACGTGGGAGAGGTCGTCTGTATCT
TCCTGACCGCTGCATTGGGTTTCCCTGAGGCGCTGATCCC
CGTCCAGCTGCTGTGGGTGAACCTGGTGACTGACGGCTTG
CCTGCCACCGCTCTAGGCTTCAACCCCCCTGATCTGGACA
TCATGAACAAGCCCCCCCGAAGCGCCAAAGAGCCCCTCAT
CTCCGGATGGCTCTTTTTCAGATACTTGGCCATCGGCTGT
TATGTGGGTGCTGCTACTGTAGGAGCTGCAGCCTGGTGGT
TCATTGTTGCTGATGATGGTCCAATGATCACACTTTACCA
GCTGAGTCATTTCCTGCAGTGTTCTCCCGATAATCCTGAC
TTCCAGGACTTGGAGTGTCACGTCTTCGAGTCTCCTTACC
CCATGACCATGGCCCTGTCTGTGCTCGTCACCATTGAGAT
GTGCAACGCCCTCAACAGTCTATCCGAGAACCAGTCTCTG
GTGCGCATGCCACCCTGGGAGAATATCTGGCTGCTGGGAG
CCATCTGTCTCTCCATGTCTCTGCACTTCCTCATCCTCTA
TGTGGAGCCACTGCCGGTCATCTTCCAGATCACTCCTCTG
AATGTGACGCAGTGGATGATGGTGCTGAAGATCTCGCTGC
CTGTCATTCTCTTGGACGAGCTGCTCAAATTTGTGGCGAG
GACCTACCTGGAGCCTGGTAAAGACCTGAAGGAGGAAAAG
GAGGACAGGAGAGGCTGGTCCTTCTCTGCATGCACTGACG
GCGTCTCCTGGCCCTTCATAGCTCTCACACTCCCTCTGGT
GGTGTGGCTGTACAGCACTAACATAACCCAGCTCTTCCGG
CACTCCTGACTGATCCCAGACCTGACTCCAAATAACCAGA
GACACAACATTCATTAACAAGGAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations