ZFIN ID: ZDB-TSCRIPT-090929-7554
Transcript Name: arl6ip1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024743 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024743|OTTDARG00000019953|ZDB-GENE-040426-1087 arl6ip1|no_translation arl6ip-003 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 781 bp
TTTTAATTTCGCAAAACATTTATTACTTGCTATTGTGGTG
GTTAAATGTATTTTAGATATTGTAATTAATTAGTTCTAGT
TTGGGGAGGGTTTTGAGGAGTCTAATTATCTATTTTTTTG
TTCCTGCACAGGACCACAGAACAGCAGCAGCGTTTTCATG
AGATCTGTGGAAACCTTGTGAAGACTCAGCGCCGTGTGCT
CGGCTGGTGGAAACGTCTGTTTGCCCTGAAGGAAGAAAAG
CCAAAAATGTATTTCCTCTCTGTGATCAGCAGTCTTGTGG
CTGTGGCCTGGATTGGACAACAAGTTCATAACCTCTTCCT
CACCTACCTGATAGTGAGTTTCCTTCTGCTGCTTCCTGGC
CTCAACCAGCATGGCATCATCACCAAATATGCTGGCATGG
CAAAGAGAGAAATCAACAAACTTCTTAAACAGAAGGAGAA
GAAGAACGAGTAAAAGATAAAGCTCGAGTGAAAACAATTC
AGAAGGCTGAAAATTCAGACAAATTTGAGTTTAATGTGGT
CATCTTCCCTGCTTATCGTCAAATTTCCACAGACCAACGT
AAAGCTTTTGCAGAAACTAAGCTGATAGTGATAAGTAACA
TCTAGAGAACAGCTTAAATGTATGCAGAGATCTCTTAAGG
TTCACGTATAACTTTGTTTTTAGGTTTCAGTTTGAAGTAT
ACATTTGTTTTCCATCAAAAGTGTTTTATTTTTTCAATGC
TGAAATACTCATTTCAGCTCTTACAGTCATGTATATTTGC
ATGTCATAGCACATTTAATAA

arl6ip1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arl6ip1-201 (1)    Ensembl 1590
arl6ip1-202 (1)    Ensembl 615
ncRNA arl6ip1-003 781
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arl6ip1-003 Contained in:
[BAC] DKEY-66I24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024743 (1),  Ensembl_Trans:ENSDART00000145382 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT596100 (1) 786 nt
CITATIONS (2)