ZFIN ID: ZDB-TSCRIPT-090929-7553
Transcript Name: arl6ip1-202
Previous Name: arl6ip1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024742 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024742|OTTDARG00000019953|ZDB-GENE-040426-1087 arl6ip1|OTTDARP00000020404 arl6ip-002 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 615 bp
GTTACTTATACGTGTGAATTTAGAGAATAGAAAGTAGAAA
CGCCACAGATATGAACTGCGTGGTAAGATGTTAGCAAGCT
AACGTTAACGCGCTGCTAACAACACGGATTACTATGAAGC
ATCTCGCTAACGTAAATGGCTTTCCCACACACATTTTTGG
CTCAAGAGACGAGTCAGTTGGAAGAGCAACTGCAGGGATG
GGGAGAGGTCATCCTGGCTGGAGATCAGATCCTGCGCTGG
GAGAAGCCATGGTTCCCTGGTGCATTAGTGAGCGTTACTA
CAATCCTCTTCACGCTGATCTACTACCTGGACCCCTCTGT
GCTCACTGGTCTGTCCTGCACTGTCATGATCCTGTGCCTG
GCTGATTACCTTGTGCCCACTCTTGCTCCTCGTGTCTTTG
GTTCCAACAAATGGACCACAGAACAGCAGCAGCGTTTTCA
TGAGATCTGTGGAAACCTTGTGAAGACTCAGCGCCGTGTG
CTCGGCTGGTGGAAACGTCTGTTTGCCCTGAAGGAAGAAA
AGCCAAAAATGTATTTCCTCTCTGTGATCAGCAGTCTTGT
GGCTGTGGCCTGGATTGGACAACAAGTTCATAACCTCTTC
CTCACCTACCTGATA

arl6ip1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arl6ip1-201 (1)    Ensembl 1590
arl6ip1-202 615
ncRNA arl6ip1-003 (1)    Ensembl 781
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arl6ip1-202 Contained in:
[BAC] DKEY-66I24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024742 (1),  Ensembl_Trans:ENSDART00000139090 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT882184 (1) 752 nt
CITATIONS (2)