ZFIN ID: ZDB-TSCRIPT-090929-7552
Transcript Name: arl6ip1-201
Previous Name: arl6ip1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024741 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024741|OTTDARG00000019953|ZDB-GENE-040426-1087 arl6ip1|OTTDARP00000020403 arl6ip-001 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 1590 bp
CATCTATTTTTGAACGTGAACTACATTTCCCATGAGTCCT
TGTATTCCGAGTTTCAGATAAAAACATCCTGAAAATAACG
GTCGCTTGACAGACTGCCGCAGTGGAGGGGGGAGACGCGT
TCATATAATCGTGCTCCGAGGAACCTAAACTCTCAAGTAA
CATCTAATAAACCATGGCTGAGGGCGACAATAAAAGTGCA
AATCTGTTGGCTCAAGAGACGAGTCAGTTGGAAGAGCAAC
TGCAGGGATGGGGAGAGGTCATCCTGGCTGGAGATCAGAT
CCTGCGCTGGGAGAAGCCATGGTTCCCTGGTGCATTAGTG
AGCGTTACTACAATCCTCTTCACGCTGATCTACTACCTGG
ACCCCTCTGTGCTCACTGGTCTGTCCTGCACTGTCATGAT
CCTGTGCCTGGCTGATTACCTTGTGCCCACTCTTGCTCCT
CGTGTCTTTGGTTCCAACAAATGGACCACAGAACAGCAGC
AGCGTTTTCATGAGATCTGTGGAAACCTTGTGAAGACTCA
GCGCCGTGTGCTCGGCTGGTGGAAACGTCTGTTTGCCCTG
AAGGAAGAAAAGCCAAAAATGTATTTCCTCTCTGTGATCA
GCAGTCTTGTGGCTGTGGCCTGGATTGGACAACAAGTTCA
TAACCTCTTCCTCACCTACCTGATAGTGAGTTTCCTTCTG
CTGCTTCCTGGCCTCAACCAGCATGGCATCATCACCAAAT
ATGCTGGCATGGCAAAGAGAGAAATCAACAAACTTCTTAA
ACAGAAGGAGAAGAAGAACGAGTAAAAGATAAAGCTCGAG
TGAAAACAATTCAGAAGGCTGAAAATTCAGACAAATTTGA
GTTTAATGTGGTCATCTTCCCTGCTTATCGTCAAATTTCC
ACAGACCAACGTAAAGCTTTTGCAGAAACTAAGCTGATAG
TGATAAGTAACATCTAGAGAACAGCTTAAATGTATGCAGA
GATCTCTTAAGGTTCACGTATAACTTTGTTTTTAGGTTTC
AGTTTGAAGTATACATTTGTTTTCCATCAAAAGTGTTTTA
TTTTTTCAATGCTGAAATACTCATTTCAGCTCTTACAGTC
ATGTATATTTGCATGTCATAGCACATTTAATAAGTCTGTG
CAAAATATAGAGCGCTTAATTTCTTTGAATCTGTTAAATT
TGCAAGGCATCTGCCCAATATTTGCTTTAACCAATTAGAT
GCACAGAACACATCATCAGAATTCATGAAATGTAGCCTTT
TTGTCTATGAATGGCTTGGAAACATGCATTTCTGCACTGT
TCTGAAAATTGCACTGGAAAACCTGAACTGGAGTGTTTGT
GAAGGGGACGTTAGACCCATACTGCTGTACTAGTGCTGTG
TGGACCCTCATTACTGTCCTCTAGCTCTAGCCATTTTCCA
ATTGAAAACCTCTCGTTGTGTGTGTGTGTGAGTGTGCGCG
TGTGTGTGTATATATTTATACACGTTCATTTCCTCTCTGT
TGTGTGTTCTATCAGCTTGTCTTAAGTTTGTCTTCTCTCC
ATGTCATTTTACCTGTCGTTTTGTTTGTGTTCTTTAAAGC
ATTAAACTGATTTGAAACTAGATTTTGTAA

arl6ip1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arl6ip1-201 1590
arl6ip1-202 (1)    Ensembl 615
ncRNA arl6ip1-003 (1)    Ensembl 781
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arl6ip1-201 Contained in:
[BAC] DKEY-66I24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024741 (1),  Ensembl_Trans:ENSDART00000058955 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY398312 (1) 1581 nt
GenBank:BC049496 (1) 1545 nt
GenBank:BC062864 (1) 1492 nt
GenBank:CK868276 (1) 781 nt
CITATIONS (2)