Transcript

atp6v1h-202

ID
ZDB-TSCRIPT-090929-7328
Name
atp6v1h-202
Previous Names
  • atp6v1h-004
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024462 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024462|OTTDARG00000010173|ZDB-GENE-021219-2 atp6v1h|OTTDARP00000038228 atp6v1h-004 LG_none AL929271.4,AL929096.5 Danio rerio protein_coding KNOWN, 564 bp
GGTCCCGTGACGTCTTGTTGCAATTTGACAGCAGAGGAAG
CAGATCCTTAAATATAAAATCTGAAGATGGACATCCGAGG
GGCAGTGGACGCTGCCGTCCCCACCAATATCATTGCAGCG
AAGGCCGCAGAAGTCCGAGCAAACAAGGTCAACTGGCAGT
CCTACCTTCAGGGCCAAATGATCTCCGGCGAGGACTGCGA
GTTCATTAAGAAGTTTGAGGTTGCTGGATCTGAGGACAAG
CAAGCAATTCTGACAAACGAAGGACATCAGTGTGCAAAGA
CCTTCCTCAACCTTATGGCTCATATATCTAAGGAGCAAAC
CGTTCAGTACATCCTGACCCTGATTGATGACACACTGCAG
GCTGTTGGAAGTGTCTGATGACCCTCAGGTTATTGCCGTC
GCAGCTCACGACGTGGGGGAATACGTGAGACATTACCCTC
GCGGCAAGAGGGTGATCGAACAGCTGGGTGGTAAACAACT
AGTGATGAACCACATGCATCATGAAGACCAGCTTGTCCGC
TATAATGCCCTGCTGGCCGTCCAGAAGCTCATGGTGCATA
ACTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations