Transcript

atp6v1h-003

ID
ZDB-TSCRIPT-090929-7327
Name
atp6v1h-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024461 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024461|OTTDARG00000010173|ZDB-GENE-021219-2 atp6v1h|no_translation atp6v1h-003 LG_none AL929271.4,AL929096.5 Danio rerio protein_coding KNOWN, 717 bp
CGTGTACGTGTATTTTTCTTTTGGACCTGTACAGAGCTCC
CAGTACGTTCAGTGTGTCGCTGGCTGCCTACAGCTGATGC
TGAGAGTCAATGAATACAGATTTGCCTGGGTGGAGGCCGA
TGGAGTGAACTGCATCACGGCAGTGCTGAGCAATAAGTGT
GGCTTCCAGCTGCAGTATCAGATGATCTTCTGCGTGTGGC
TCCTGGCATTCAGCCCGCAGCTCTGCGAACAGCTGCGGCG
CTACAACGTGGTACCAGCCCTCTCCGACATCCTCCAAGAG
TCTGTCAAAGAGAAGGTCACTCGCATAATTCTGGCTGCTT
TCAGGAACCTGCTGGAGAAATCAGCCGAAAGAGAGACTCG
TCAGGAGTATGCGCTTGCCATGATCCAGTGCAAAGTGCTA
AAACAGCTGGAGAACCTGGACCAGCAGAAATACGATGATG
AGGACATCACCGATGATATTAAATTCCTCCTGGAAAGACT
GGGAGAGAGTGTTCAAGATCTCAGGTAAAGATTGTAAGAT
TGATTTCGACTTTTGCGTTAAGTGGTCATCATACACTATG
ACGCATAACTTGCATGTACCCGAAGCCGCTGTAGATATTT
ATACTTCTGCGTTCTCTCTGTGCTGCTCTGGGAATAATGC
AATATCAATAATAACGTTAGCAGGCAGTGGGGTTTCTGTG
TTTCACTGTGTCGAGTTTCTTTGCTGGTGTTTACTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations