Transcript

atp6v1h-204

ID
ZDB-TSCRIPT-090929-7326
Name
atp6v1h-204
Previous Names
  • atp6v1h-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024460 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024460|OTTDARG00000010173|ZDB-GENE-021219-2 atp6v1h|OTTDARP00000020185 atp6v1h-002 LG_none AL929271.4,AL929096.5 Danio rerio protein_coding KNOWN, 1496 bp
GTTGCAATTTGACAGCAGAGGAAGCAGATCCTTAAATATA
AAATCTGAAGATGGACATCCGAGGGGCAGTGGACGCTGCC
GTCCCCACCAATATCATTGCAGCGAAGGCCGCAGAAGTCC
GAGCAAACAAGGTCAACTGGCAGTCCTACCTTCAGGGCCA
AATGATCTCCGGCGAGGACTGCGAGTTCATTAAGAAGTTT
GAGGTTGCTGGATCTGAGGACAAGCAAGCAATTCTGACAA
ACGAAGGACATCAGTGTGCAAAGACCTTCCTCAACCTTAT
GGCTCATATATCTAAGGAGCAAACCGTTCAGTACATCCTG
ACCCTGATTGATGACACACTGCAGGAAAATCATCAGAGAG
TGAATATCTTCTTTGATTATGCAAAGAAGACTAAGAATAC
AGCCTGGTCATACTTCCTCCCAATGCTGAACCGTCAAGAC
CTCTTTACTGTTCACATGGCTGCCAGAATCATAGCCAAAC
TGGCTGCCTGGGGACGTGACCTGATGGAAGGCAGTGACTT
GAACTACTACTTCAACTGGATTAAGACCCAGCTCAGCTCT
CAGAAACTACATGGTACAGGTGCTGAACCTGGAACAGGGA
CCATCTCCCCCAGTGAAAGCTCCCAGTACGTTCAGTGTGT
CGCTGGCTGCCTACAGCTGATGCTGAGAGTCAATGAATAC
AGATTTGCCTGGGTGGAGGCCGATGGAGTGAACTGCATCA
CGGCAGTGCTGAGCAATAAGTGTGGCTTCCAGCTGCAGTA
TCAGATGATCTTCTGCGTGTGGCTCCTGGCATTCAGCCCG
CAGCTCTGCGAACAGCTGCGGCGCTACAACGTGGTACCAG
CCCTCTCCGACATCCTCCAAGAGTCTGTCAAAGAGAAGGT
CACTCGCATAATTCTGGCTGCTTTCAGGAACCTGCTGGAG
AAATCAGCCGAAAGAGAGACTCGTCAGGAGTATGCGCTTG
CCATGATCCAGTGCAAAGTGCTAAAACAGCTGGAGAACCT
GGACCAGCAGAAATACGATGATGAGGACATCACCGATGAT
ATTAAATTCCTCCTGGAAAGACTGGGAGAGAGTGTTCAAG
ATCTCAGTTCTTTTGATGAGTACAGCTCCGAGCTGAAGTC
TGGACGCCTGGAATGGAGTCCAGTGCACAAGTCAGAGAAG
TTCTGGAGGGAAAACGCTGTTCGCCTGAATGAGAAGAACT
ACGAGCTCCTGAAGATACTGACCAGGCTGTTGGAAGTGTC
TGATGACCCTCAGGTTATTGCCGTCGCAGCTCACGACGTG
GGGGAATACGTGAGACATTACCCTCGCGGCAAGAGGGTGA
TCGAACAGCTGGGTGGTAAACAACTAGTGATGAACCACAT
GCATCATGAAGACCAGCTTGTCCGCTATAATGCCCTGCTG
GCCGTCCAGAAGCTCATGGTGCATAACTGGGAGTACCTGG
GGAAGCAGTTGCAGTCCACCGAGCAGACGACTCCGGCTGT
GGCTGCACGAAGCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations