Transcript

atp6v1h-201

ID
ZDB-TSCRIPT-090929-2047
Name
atp6v1h-201
Previous Names
  • atp6v1h-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011688 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011688|OTTDARG00000010173|ZDB-GENE-021219-2 atp6v1h|OTTDARP00000010083 atp6v1h-001 LG_none AL929271.4,AL929096.5 Danio rerio protein_coding KNOWN, 1755 bp
ACGTGACACTGGTCCCGTGACGTCTTGTTGCAATTTGACA
GCAGAGGAAGCAGATCCTTAAATATAAAATCTGAAGATGG
ACATCCGAGGGGCAGTGGACGCTGCCGTCCCCACCAATAT
CATTGCAGCGAAGGCCGCAGAAGTCCGAGCAAACAAGGTC
AACTGGCAGTCCTACCTTCAGGGCCAAATGATCTCCGGCG
AGGACTGCGAGTTCATTAAGAAGTTTGAGGTTGCTGGATC
TGAGGACAAGCAAGCAATTCTGACAAACGAAGGACATCAG
TGTGCAAAGACCTTCCTCAACCTTATGGCTCATATATCTA
AGGAGCAAACCGTTCAGTACATCCTGACCCTGATTGATGA
CACACTGCAGGAAAATCATCAGAGAGTGAATATCTTCTTT
GATTATGCAAAGAAGACTAAGAATACAGCCTGGTCATACT
TCCTCCCAATGCTGAACCGTCAAGACCTCTTTACTGTTCA
CATGGCTGCCAGAATCATAGCCAAACTGGCTGCCTGGGGA
CGTGACCTGATGGAAGGCAGTGACTTGAACTACTACTTCA
ACTGGATTAAGACCCAGCTCAGCTCTCAGAGCTCCCAGTA
CGTTCAGTGTGTCGCTGGCTGCCTACAGCTGATGCTGAGA
GTCAATGAATACAGATTTGCCTGGGTGGAGGCCGATGGAG
TGAACTGCATCACGGCAGTGCTGAGCAATAAGTGTGGCTT
CCAGCTGCAGTATCAGATGATCTTCTGCGTGTGGCTCCTG
GCATTCAGCCCGCAGCTCTGCGAACAGCTGCGGCGCTACA
ACGTGGTACCAGCCCTCTCCGACATCCTCCAAGAGTCTGT
CAAAGAGAAGGTCACTCGCATAATTCTGGCTGCTTTCAGG
AACCTGCTGGAGAAATCAGCCGAAAGAGAGACTCGTCAGG
AGTATGCGCTTGCCATGATCCAGTGCAAAGTGCTAAAACA
GCTGGAGAACCTGGACCAGCAGAAATACGATGATGAGGAC
ATCACCGATGATATTAAATTCCTCCTGGAAAGACTGGGAG
AGAGTGTTCAAGATCTCAGTTCTTTTGATGAGTACAGCTC
CGAGCTGAAGTCTGGACGCCTGGAATGGAGTCCAGTGCAC
AAGTCAGAGAAGTTCTGGAGGGAAAACGCTGTTCGCCTGA
ATGAGAAGAACTACGAGCTCCTGAAGATACTGACCAGGCT
GTTGGAAGTGTCTGATGACCCTCAGGTTATTGCCGTCGCA
GCTCACGACGTGGGGGAATACGTGAGACATTACCCTCGCG
GCAAGAGGGTGATCGAACAGCTGGGTGGTAAACAACTAGT
GATGAACCACATGCATCATGAAGACCAGCTTGTCCGCTAT
AATGCCCTGCTGGCCGTCCAGAAGCTCATGGTGCATAACT
GGGAGTACCTGGGGAAGCAGTTGCAGTCCACCGAGCAGAC
GACTCCGGCTGTGGCTGCACGAAGCTGAACTGCCCTGCGT
TTCTGTATGAGCCTGTGTGTCTGATCCAGTGTCATTGGTG
TGAATGTAAATCTGTGTTATATATATAATGAACAAGGTAA
ACCAAACGGTTGTTGTATTGATCCACAAATTTATGATTTA
ACTCTTGTGCTTTTGTCGTTGTGTTATTGTGTATTGTGCG
TCCTAATAATAAAATCACGTCAAGTGATCAGGTCACAGAG
TAAAATGAAATGTTATTTATGGCTTAAGTGTAAAACGATG
AGTATGCATTCCAATAAAGAATCTACCACAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations