header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7234
Transcript Name: acp5a-206
Previous Name: acp5a-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024366 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024366|OTTDARG00000019735|ZDB-GENE-040426-2864 acp5a|OTTDARP00000020127 acp5-006 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 713 bp
GTTTTCAGTTACAGTTTGGTCAGATTTAGGAAATGTCTAA
AAATACAAGTGTAAATGCAGGAGGTTGATAGTGAAGTTTT
AGGGTACGACATAAAAATGAACCCAATGGCGTCACCACTA
ATGCTGGTGTTTTTAAGTGCTCTCCCTGGGGTCCTTTGCT
ACTATTCCTCATTCGTTGACCTGGAAGCTCAAGGAAGTAA
CCAGTCATCCATCAGGTTCCTGGTGTTGGGGGACTGGGGT
GGACTACCTAATCCTCCATATGTGACCCCCATAGAGACCG
CTACAGCCCGCATGATGGCCAAAACTGCTTCTCAGATGGG
TGCGGACTTCATTTTGGCTGTTGGTGACAACTTCTACTAC
AAGGGCGTCACTGATGTCAATGACCCTAGATTCCAGGAAA
CCTTTGAAGACGTCTACACTCAAGATTCTCTTAACATTCC
TTGGTACGTCATTGCTGGCAATCACGACCATGTAGGAAAC
GTCAAAGCTCAAATTGAGTACAGCCAGAGGTCAAAGAGAT
GGAACTTCCCCTACTACTATTATGAGATGAACTTCCGCAT
TCCTCGAACAGACAGTACTCTGACAATCATCATGCTGGAC
ACTGTGTTGCTGTGTGGCAACTCTGACGACTTTCTTGACC
AGCAGCCTCGAGCTCCACGAAGTGGTGTACTGGCCAACCG
GCAGCTGCTGTGGCTTCAGGAACGCTTGGCGAA

acp5a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA acp5a-002 (1) 814
acp5a-003 (1) 705
acp5a-005 (1) 540
mRNA acp5a-201 (1) 1808
acp5a-203 (1) 622
acp5a-206 713
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acp5a-206 Contained in:

OTHER acp5a-206 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024366 (1)
  • Ensembl_Trans:ENSDART00000142752 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK700015 (1) 717bp
    CITATIONS (2)