Transcript

acp5a-206

ID
ZDB-TSCRIPT-090929-7234
Name
acp5a-206
Previous Names
  • acp5a-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024366 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024366|OTTDARG00000019735|ZDB-GENE-040426-2864 acp5a|OTTDARP00000020127 acp5-006 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 713 bp
GTTTTCAGTTACAGTTTGGTCAGATTTAGGAAATGTCTAA
AAATACAAGTGTAAATGCAGGAGGTTGATAGTGAAGTTTT
AGGGTACGACATAAAAATGAACCCAATGGCGTCACCACTA
ATGCTGGTGTTTTTAAGTGCTCTCCCTGGGGTCCTTTGCT
ACTATTCCTCATTCGTTGACCTGGAAGCTCAAGGAAGTAA
CCAGTCATCCATCAGGTTCCTGGTGTTGGGGGACTGGGGT
GGACTACCTAATCCTCCATATGTGACCCCCATAGAGACCG
CTACAGCCCGCATGATGGCCAAAACTGCTTCTCAGATGGG
TGCGGACTTCATTTTGGCTGTTGGTGACAACTTCTACTAC
AAGGGCGTCACTGATGTCAATGACCCTAGATTCCAGGAAA
CCTTTGAAGACGTCTACACTCAAGATTCTCTTAACATTCC
TTGGTACGTCATTGCTGGCAATCACGACCATGTAGGAAAC
GTCAAAGCTCAAATTGAGTACAGCCAGAGGTCAAAGAGAT
GGAACTTCCCCTACTACTATTATGAGATGAACTTCCGCAT
TCCTCGAACAGACAGTACTCTGACAATCATCATGCTGGAC
ACTGTGTTGCTGTGTGGCAACTCTGACGACTTTCTTGACC
AGCAGCCTCGAGCTCCACGAAGTGGTGTACTGGCCAACCG
GCAGCTGCTGTGGCTTCAGGAACGCTTGGCGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations