ZFIN ID: ZDB-TSCRIPT-090929-7231
Transcript Name: acp5a-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024363 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024363|OTTDARG00000019735|ZDB-GENE-040426-2864 acp5a|no_translation acp5-003 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 705 bp
TGGTATGAGGTGTGGAGAGAGGACTCTCAAAGAGCAGAAG
CTGCTGGTGTAGGTGCTTTCTGATGGCGTCACCACTAATG
CTGGTGTTTTTAAGTGCTCTCCCTGGGGTCCTTTGCTACT
ATTCCTCATTCGTTGACCTGGAAGCTCAAGGAAGTAACCA
GTCATCCATCAGGTTCCTGGTGTTGGGGGACTGGGGTGGA
CTACCTAATCCTCCATATGTGACCCCCATAGAGACCGCTA
CAGCCCGCATGATGGCCAAAACTGCTTCTCAGATGGGTGC
GGACTTCATTTTGGCTGTTGGTGACAACTTCTACTACAAG
GGCGTCACTGATGTCAATGACCCTAGATTCCAGGAAACCT
TTGAAGACGTCTACACTCAAGATTCTCTTAACATTCCTTG
GTACGTCATTGCTGGCAATCACGACCATGTAGGAAACGTC
AAAGCTCAAATTGAGTACAGCCAGAGGTCAAAGAGATGGA
ACTTCCCCTACTACTATTATGAGATGAACTTCCGCATTCC
TCGAACAGACAGTACTCTGACAATCATCATGCTGGACACT
GTGTTGCTGTGTGGCAACTCTGACGACTTTCTTGACCAGC
AGCCTCGAGCTCCACGAAGTGGTGTACTGGCCAACCGGCA
GCTGCTGTGGCTTCAGGAACGCTTGGCGAAGTCCAAAGCT
GATTATCTCCTGGTGGCCGGCCATT

acp5a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA acp5a-001 (1) 1808
ncRNA acp5a-002 (1) 814
acp5a-003 705
mRNA acp5a-004 (1) 622
ncRNA acp5a-005 (1) 540
mRNA acp5a-006 (1) 713
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acp5a-003 Contained in:
OTHER acp5a-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024363 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CV119087 (1) 741bp
    CITATIONS (1)