Transcript

acp5a-003

ID
ZDB-TSCRIPT-090929-7231
Name
acp5a-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024363 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024363|OTTDARG00000019735|ZDB-GENE-040426-2864 acp5a|no_translation acp5-003 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 705 bp
TGGTATGAGGTGTGGAGAGAGGACTCTCAAAGAGCAGAAG
CTGCTGGTGTAGGTGCTTTCTGATGGCGTCACCACTAATG
CTGGTGTTTTTAAGTGCTCTCCCTGGGGTCCTTTGCTACT
ATTCCTCATTCGTTGACCTGGAAGCTCAAGGAAGTAACCA
GTCATCCATCAGGTTCCTGGTGTTGGGGGACTGGGGTGGA
CTACCTAATCCTCCATATGTGACCCCCATAGAGACCGCTA
CAGCCCGCATGATGGCCAAAACTGCTTCTCAGATGGGTGC
GGACTTCATTTTGGCTGTTGGTGACAACTTCTACTACAAG
GGCGTCACTGATGTCAATGACCCTAGATTCCAGGAAACCT
TTGAAGACGTCTACACTCAAGATTCTCTTAACATTCCTTG
GTACGTCATTGCTGGCAATCACGACCATGTAGGAAACGTC
AAAGCTCAAATTGAGTACAGCCAGAGGTCAAAGAGATGGA
ACTTCCCCTACTACTATTATGAGATGAACTTCCGCATTCC
TCGAACAGACAGTACTCTGACAATCATCATGCTGGACACT
GTGTTGCTGTGTGGCAACTCTGACGACTTTCTTGACCAGC
AGCCTCGAGCTCCACGAAGTGGTGTACTGGCCAACCGGCA
GCTGCTGTGGCTTCAGGAACGCTTGGCGAAGTCCAAAGCT
GATTATCTCCTGGTGGCCGGCCATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations