ZFIN ID: ZDB-TSCRIPT-090929-7229
Transcript Name: acp5a-201
Previous Name: acp5a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024361 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024361|OTTDARG00000019735|ZDB-GENE-040426-2864 acp5a|OTTDARP00000020125 acp5-001 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 1808 bp
GGCGTTAGTTTGGTATGAGGTGTGGAGAGAGGACTCTCAA
AGAGCAGAAGCTGCTGGTATGGCGTCACCACTAATGCTGG
TGTTTTTAAGTGCTCTCCCTGGGGTCCTTTGCTACTATTC
CTCATTCGTTGACCTGGAAGCTCAAGGAAGTAACCAGTCA
TCCATCAGGTTCCTGGTGTTGGGGGACTGGGGTGGACTAC
CTAATCCTCCATATGTGACCCCCATAGAGACCGCTACAGC
CCGCATGATGGCCAAAACTGCTTCTCAGATGGGTGCGGAC
TTCATTTTGGCTGTTGGTGACAACTTCTACTACAAGGGCG
TCACTGATGTCAATGACCCTAGATTCCAGGAAACCTTTGA
AGACGTCTACACTCAAGATTCTCTTAACATTCCTTGGTAC
GTCATTGCTGGCAATCACGACCATGTAGGAAACGTCAAAG
CTCAAATTGAGTACAGCCAGAGGTCAAAGAGATGGAACTT
CCCCTACTACTATTATGAGATGAACTTCCGCATTCCTCGA
ACAGACAGTACTCTGACAATCATCATGCTGGACACTGTGT
TGCTGTGTGGCAACTCTGACGACTTTCTTGACCAGCAGCC
TCGAGCTCCACGAAGTGGTGTACTGGCCAACCGGCAGCTG
CTGTGGCTTCAGGAACGCTTGGCGAAGTCCAAAGCTGATT
ATCTCCTGGTGGCCGGCCATTATCCAGTGTGGTCCATATC
CGAGCACGGGCCAACTGACTGCCTGCTGAAGAATTTGAGG
CCATTACTAAAGAAGTACAAGGCCACGGCTTACCTTTGTG
GCCATGATCACAACCTACAATACATCAAGGAGTCTGGTAT
TGGTTATGTAGTTAGTGGAGCTGGTAACTTTATGGATCCT
GATGTGCGCCACCGCAACCGCGTTCCCAAAGGCTACCTTA
AGTTCTTCAATGGCGATGCCTCAACATTGGGTGGTTTTGC
TCACATTGAGGTTGATAAGAAACAGATGACCGTTACGTTT
ATCCAGGCTAGAGGAACCTCTCTGTACCGGGCTGTTCTTA
AGAAGCGTGACGACGTTCTTGAGGACGACAACTTTTGAAA
TTTTTAGTTTTTATGTGACTGGGTATATTTACCCTGGTCT
TTTAGATTTTATGTTGTGAATTGAAAACTTGCTCAAGATC
TGTTTTAAAAAAAAAAAAAGTGCAGTTTTACAATCCTTTA
TTTATAGATTTAAGTTTAATGAATTGTTTTAAACATGGAA
CTTTTTAATAATGATTAATTAAATGTTCATTTAAACTACT
ACTGATCAACTGAAGTGTCCGCTACTTTTTCCTTTTTATA
TACAAGAGTAAGGATTCATCTATTCTGGACTCTTAACCTC
AGTGCTAGAGTCTACTTTGAATGTATTCCTAATAATGAAA
GCTTAAGTTAACTGTTGATATTTGAAAGCAAAGTAGACAT
GCTCATAACTTATCAGGACACTGGTTATTTTTGTAACGTG
CTTTCACTGCTGATTGGTAGGTGACTAACTTTGAATTTTT
ACTGGAAACCTCAAACCAGTGATCAATGAAAATCCTTGCA
TTGAAATCAGGATACATTCATATTGAACATTATTTAAAGA
AGCTTGTAATGTTCAATGTAGATTTCACACGAGGAACAGT
AAGGTAAACATTTGGGCAATATTCTTAAGGTTTATTTAAA
AAAAAAAAAAAAAAAAAAAAAAGTGCTTACTAAAAATAAT
TCAGATTAAGATGTCTTTTTGTCAACTTGGTGGTACGGCT
GCCTAGATTTGCAACTTTCCATTTGCACCGCACCTTATCT
TGTTCTCA

acp5a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA acp5a-002 (1) 814
acp5a-003 (1) 705
acp5a-005 (1) 540
mRNA acp5a-201 1808
acp5a-203 (1) 622
acp5a-206 (1) 713
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acp5a-201 Contained in:
OTHER acp5a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024361 (1)
  • Ensembl_Trans:ENSDART00000004716 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055256 (1) 1690bp
    GenBank:CA474853 (1) 849bp
    GenBank:DV598142 (1) 818bp
    GenBank:CK237024 (1) 789bp
    GenBank:CN022724 (1) 721bp
    GenBank:CK696592 (1) 601bp
    GenBank:CV488934 (1) 596bp
    GenBank:AW116349 (1) 595bp
    GenBank:CB890993 (1) 560bp
    GenBank:BI867858 (1) 512bp
    GenBank:BM082819 (1) 366bp
    CITATIONS (2)