header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7232
Transcript Name: acp5a-203
Previous Name: acp5a-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024364 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024364|OTTDARG00000019735|ZDB-GENE-040426-2864 acp5a|OTTDARP00000020126 acp5-004 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 622 bp
AGACACGCTGAGCATGAGGACGCTGAGGACTGAGCCACTC
AATCATTATGGCGTCACCACTAATGCTGGTGTTTTTAAGT
GCTCTCCCTGGGGTCCTTTGCTACTATTCCTCATTCGTTG
ACCTGGAAGCTCAAGGAAGTAACCAGTCATCCATCAGGTT
CCTGGTGTTGGGGGACTGGGGTGGACTACCTAATCCTCCA
TATGTGACCCCCATAGAGACCGCTACAGCCCGCATGATGG
CCAAAACTGCTTCTCAGATGGGTGCGGACTTCATTTTGGC
TGTTGGTGACAACTTCTACTACAAGGGCGTCACTGATGTC
AATGACCCTAGATTCCAGGAAACCTTTGAAGACGTCTACA
CTCAAGATTCTCTTAACATTCCTTGGTACGTCATTGCTGG
CAATCACGACCATGTAGGAAACGTCAAAGCTCAAATTGAG
TACAGCCAGAGGTCAAAGAGATGGAACTTCCCCTACTACT
ATTATGAGATGAACTTCCGCATTCCTCGAACAGACAGTAC
TCTGACAATCATCATGCTGGACACTGTGTTGCTGTGTGGC
AACTCTGACGACTTTCTTGACCAGCAGCCTCGAGCTCCAC
GAAGTGGTGTACTGGCCAACCG

acp5a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA acp5a-002 (1) 814
acp5a-003 (1) 705
acp5a-005 (1) 540
mRNA acp5a-201 (1) 1808
acp5a-203 622
acp5a-206 (1) 713
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acp5a-203 Contained in:

OTHER acp5a-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024364 (1)
  • Ensembl_Trans:ENSDART00000135810 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK712951 (1) 606 bp
    GenBank:BI839315 (1) 573 bp
    GenBank:CK709411 (1) 562 bp
    GenBank:BI709333 (1) 551 bp
    GenBank:CB363705 (1) 514 bp
    CITATIONS (2)