Transcript

ccdc65-002

ID
ZDB-TSCRIPT-090929-7206
Name
ccdc65-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNACentral
Note
None
Sequence
OTTDART00000024338 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024338|OTTDARG00000019724|ZDB-GENE-030616-358 ccdc65|no_translation ccdc65-002 LG_6 AL953886.9 Danio rerio protein_coding KNOWN, 539 bp
CAGGATTCCATCTCTACTTTCCGTGGTCAGCTGAGCTCTG
GTCAGACTGATAAAACAGCGGAGCAGCTTCGTTCTGAACG
TGATGAACTCGCACAGGAAGTTCAACACTTCAGAGTCCAG
CTCAATGCGGCGCAGGCCATCCGGAAAAAACACATTACTA
AACTGACTGTTCAAAGCAACGACGCTACCAAAAAACTGCA
GGAGATCGTAGCAAGGGGGGAAAGGCTGCTGCGTCAGTGC
GAGATGTGCTGTAAACTGGAGACGGAGCACGAGAAGGTTT
TGCCCTTCTACAAGTCATCACTGAGCGAAGAAGAGCAAAA
ACAGGAGAAAGCCAAAGCCATGGAGTCTTCAAATGAGAAA
CTCACACAGCTAATGCATGACTATTCGCCTCTTGCGAAGT
TCTGGCAACGCTACAACAAAGTTGAGCTGGACTGTTTGTG
TGTGAAGCGAGAGAAGCTGCTTCTGCTCCAGGAGAATGAG
CGTCTGAGGCTCTTTCTGAAGCAGTACCTGGATGAAGTCT
CGGTTTCTGATGAGAGTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations