header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22574
Transcript Name: ottdart00000001492
Previous Names: busm1-202l16.3-001, si:busm1-202l16.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001492 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001492|OTTDARG00000001383|ZDB-GENE-030616-358 ccdc65|OTTDARP00000001310 BUSM1-202L16.3-001 LG_ AL591389.5 Danio rerio protein_coding NOVEL, 1344 bp
AAAGAAGAGAAGAACACTGTACTGAACCTCCACAAGCTGC
GTCAGCAATGGCGAGCTGTTTTGACGCAGACAAAGATAGC
AGAGCTGCGCAATGACATGTCAGTCCTCTCGCAGACCTTC
GAGAGAGTCCTGGACTACAAAGACAACATCATTAGGAGTT
TGCAGGTTGATTTGTCAGAGAGGGAGCTTCAGTCGGAGCT
GAAGCGCAGTTCACATCTGCACAACGTGGACTGTCTGTTA
GAGATTCATAAGAGTCGACTGGCACAACTAGAGTTCAACT
TCAAGAGCAGTCTAGTGGAACTTAGCTCAGAGTATAATAC
TGAGAGGGAGCAGATTCTCTCCCAGCACCAGCAGGAATGT
GTGGATTTGGACAATGTGATGTTTTCCATGGAAAAGCACT
ACAGTGATCTCGATGGAGAGGCGAAACGTGATTATCAGAG
CACTCGCAATCAAATAAAAAAACGGAACTTTGATGATAAG
CAAGCGGTGAAAGAGCAGATGGATGGAGTTGTGGAGAAAC
TGTGGCAGGACCAGCAGCAGGTTTTAAACCACTACAACGA
GTCCACCAGAGACAAAATCATCACGACCGATGATCTGATG
AACAAGGATGTGCAAAGTGCCAAAGAAATCGACTCGCTTA
AAAAACACATTCAGAAGCTGCAGGATTCCATCTCTACTTT
CCGTGGTCAGCTGAGCTCTGGTCAGACTGATAAAACAGCG
GAGCAGCTTCGTTCTGAACGTGATGAACTCGCACAGGAAG
TTCAACACTTCAGAGTCCAGCTCAATGCGGCGCAGGCCAT
CCGGAAAAAACACATTACTAAACTGACTGTTCAAAGCAAC
GACGCTACCAAAAAACTGCAGGAGATCGTAGCAAGGGGGG
AAAGGCTGCTGCGTCAGTGCGAGATGTGCTGTAAACTGGA
GACGGAGCACGAGAAGGTTTTGCCCTTCTACAAGTCATCA
CTGAGCGAAGAAGAGCAAAAACAGGAGAAAGCCAAAGCCA
TGGAGTCTTCAAATGAGAAACTCACACAGCTAATGCATGA
CTATTCGCCTCTTGCGAAGTTCTGGCAACGCTACAACAAA
GTTGAGCTGGACTGTTTGTGTGTGAAGCGAGAGAAGCTGC
TTCTGCTCCAGGAGAATGAGCGTCTGAGGCTCTTTCTGAA
GCAGTACCTGGATGAAGTCTCGGTTTCTGATGAGAGTTTT
CGGCAGCAGAAGCTTCTGGTGGTGTCGAGTCCTGCTCTTC
AGGATACTGCTGCCACTGACAGACATCAGCAGAAAAGACA
CGTTGTGCAAGAAGCAGCCTGTATTGTGCAGAAACAGCTT
TAGAGAATAAATGTAGAAAAACAA

ccdc65 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ccdc65-201 (1) 1531
ottdart00000001492 1344
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001492 Contained in:

OTHER ottdart00000001492 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001492 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI672285 (1) 631bp
    GenBank:BQ074640 (1) 626bp
    GenBank:BQ075461 (1) 543bp
    GenBank:BQ074855 (1) 532bp
    GenBank:BI840731 (1) 490bp
    CITATIONS (1)