Transcript

ccdc65-201

ID
ZDB-TSCRIPT-090929-7205
Name
ccdc65-201
Previous Names
  • ccdc65-001
  • ottdart00000024337
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024337 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024337|OTTDARG00000019724|ZDB-GENE-030616-358 ccdc65|OTTDARP00000020112 ccdc65-001 LG_ AL953886.9 Danio rerio protein_coding KNOWN, 1531 bp
GGAATTCTGAAATCTCCGAAATTCTGCAAACATGCCTAAA
AAAGCAGGGAAGAAGGCCGGTGGAAAACTGGCCGGGTTGA
CGGAGGAGGAGAGACTCCTGTACATGCAGCAAAAGGCTCA
AGCGGAGGAGGAAATCGCCAAGAGAAAAGAGGACATGCTC
ACACACTTCCTCAAGGATAAACTGCAGAAAGAAGAGAAGA
ACACTGTACTGAACCTCCACAAGCTGCGTCAGCAATGGCG
AGCTGTTTTGACGCAGACAAAGATAGCAGAGCTGCGCAAT
GACATGTCAGTCCTCTCGCAGACCTTCGAGAGAGTCCTGG
ACTACAAAGACAACATCATTAGGAGTTTGCAGGTTGATTT
GTCAGAGAGGGAGCTTCAGTCGGAGCTGAAGCGCAGTTCA
CATCTGCACAACGTGGACTGTCTGTTAGAGATTCATAAGA
GTCGACTGGCACAACTAGAGTTCAACTTCAAGAGCAGTCT
AGTGGAACTTAGCTCAGAGTATAATACTGAGAGGGAGCAG
ATTCTCTCCCAGCACCAGCAGGAATGTGTGGATTTGGACA
ATGTGATGTTTTCCATGGAAAAGCACTACAGTGATCTCGA
TGGAGAGGCGAAACGTGATTATCAGAGCACTCGCAATCAA
ATAAAAAAACGGAACTTTGATGATAAGCAAGCGGTGAAAG
AGCAGATGGATGGAGTTGTGGAGAAACTGTGGCAGGACCA
GCAGCAGGTTTTAAACCACTACAACGAGTCCACCAGAGAC
AAAATCATCACGACCGATGATCTGATGAACAAGGATGTGC
AAAGTGCCAAAGAAATCGACTCGCTTAAAAAACACATTCA
GAAGCTGCAGGATTCCATCTCTACTTTCCGTGGTCAGCTG
AGCTCTGGTCAGACTGATAAAACAGCGGAGCAGCTTCGTT
CTGAACGTGATGAACTCGCACAGGAAGTTCAACACTTCAG
AGTCCAGCTCAATGCGGCGCAGGCCATCCGGAAAAAACAC
ATTACTAAACTGACTGTTCAAAGCAACGACGCTACCAAAA
AACTGCAGGAGATCGTAGCAAGGGGGGAAAGGCTGCTGCG
TCAGTGCGAGATGTGCTGTAAACTGGAGACGGAGCACGAG
AAGGTTTTGCCCTTCTACAAGTCATCACTGAGCGAAGAAG
AGCAAAAACAGGAGAAAGCCAAAGCCATGGAGTCTTCAAA
TGAGAAACTCACACAGCTAATGCATGACTATTCGCCTCTT
GCGAAGTTCTGGCAACGCTACAACAAAGTTGAGCTGGACT
GTTTGTGTGTGAAGCGAGAGAAGCTGCTTCTGCTCCAGGA
GAATGAGCGTCTGAGGCTCTTTCTGAAGCAGTACCTGGAT
GAAGTCTCGGTTTCTGATGAGAGTTTTCGGCAGCAGAAGC
TTCTGGTGGTGTCGAGTCCTGCTCTTCAGGATACTGCTGC
CACTGACAGACATCAGCAGAAAAGACACGTTGTGCAAGAA
GCAGCCTGTATTGTGCAGAAACAGCTTTAGAGAATAAATG
TAGAAAAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations