ZFIN ID: ZDB-TSCRIPT-090929-6359
Transcript Name: lmo4a-201
Previous Names: lmo4-001, lmo4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023185 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023185|OTTDARG00000018966|ZDB-GENE-010702-1 lmo4a|OTTDARP00000019299 lmo4-001 LG_ CR855258.6 Danio rerio protein_coding KNOWN, 1895 bp
GTAATTTCAGCGTAAACTGACGCCAGATACACGATTCTGC
AGCTTGTAGGAGGTTTTAGGTTCTGTTAGGAAACGAGTGG
TTATAATAAGTAGTTTAAAGGTAACATCACGAAGATAATG
TGTAATAGCGCGACTCAAACGCGAGTTTGACGGTTGTGGT
AAAGCACTTCTTCAAGCAAGAAGGACGATTCTGAAGTTTC
TGGAACCGAGGCTCTCGGATTATCAAAAGCGCATTTTCTT
CAACGGTTTTGGGGTGGATGAAAGCAAAACAAGTTTGAGG
ACAGCCACTTTATCACTGTTTGATACCTCACAGTAACTTC
TGAAGTGATTCCAGCACCCCTTGACCTTCGAGATACGTAC
AAATAACGGCAGGCAATGGTGAACAGTCGTGTGGAAAGCT
CCGCGGTTGCGGTAACAGGAGGCAGTGGTGGGGCCGTACG
CTCCTGTGCTGGATGCGGTGGTCGGATATCGGACCGCTTT
CTGCTCTTCTCTATGGATCGGTACTGGCACACGCGCTGCC
TCAAGTGCTCCTGCTGCCAGGCTCAGCTGGGAGAGATCGG
CAGCACCTGCTTCAGCAAAGGAGGGATGATCCTCTGCAGG
AACGATTACATCAGGTTGTTTGGTCACAGTGGAGCTTGCA
GTGCGTGTGGACAGTCTATTCCTGCCAGTGAGATGGTGAT
GAGGGCCCAGGGTAACGTCTACCATCTAAAGTGTTTTACC
TGTGCCACTTGCCGAAATCGCTTGGTTCCTGGTGACAGAT
TTCACTATGTCAACGGCACCATTTTTTGTGAGCATGATCG
ACCAGGTGGAGCTTTGCTCAGTAGTCATCTGACCCCCCTG
CAGAGCAACACCCTGCTGCCCGACCAAAAGGTGTGCTGAG
GAAATCTGGATTTATTATTTGCGGTGTGCCTTCTCTTCAG
TCCTTTCCTCACATCTTCCCTCCAATCTCTCCTCGTGAAT
GTCCACCTTCACCCGAGACCTTCTGCCCACTTCTGCGCAT
CCAGCCACCTTAAAAGAGTTCAGAACTACGCAAGTACTGT
GAGTCACTTGTGAGACAATCACCCCTGACAAGGGAAAACG
TAATCAAGTCGAAGAAAGACACGGAAGCTAAAAATAATCA
TACGCACTCCCTCAGATGCGGTCTGTGGTTATGGCTGGGA
TGCCCTGACCCTGAAAGCCTTAGACTCATTTTCAAGAGCA
GCTCTTTAAAGCTGGGGTGATGCTCAACACCATTTTGTTC
CCTTTTGAGAAGTTTCTCAAGAAATGTTGTGGACATCACC
TGACATTTTGGACTACGGATGGTGATGGTTTTTACTTTAT
GCCCTCAAAACGACATCCATATATCAAAAGACTTTTTCAG
TGGTTGTTGCTTTTGTTTACAGGCCCTTTTCACTCTAAGT
GTAAGTTTATTCCTTCCTTTTTTTGAACATGTTCTGTCGT
CTTTGGTGCCTAAAAACATTTTTACTTCCGGTTTTCCCTC
CATTGTCATTTACTTCCTATTAGCAAGTAATCGTACACAT
GCACAGTACAGATACGTGAACATGTATTGTTTTGTCTACT
CGAGTTTAAGACATACGAAGAGCTCTTTTTGAAAGAGTTG
GTCTCATGAGGAAACGGCATGTTTTTTTTTTTCCTCCCCC
TGAATGGTTTGGTAGAATAAATAAATCTGTATGCATATTC
TCTAATAGAGACTGCTATTCAGTGTCTGCCAAGACTTTTG
AGAGTATGAAGGAGATGGAGAGTAAAATTGTACATATTTC
ATGTGCTGTTGTGTGTTGTGTTCAGTGGTTGACCTGTTTC
CTTGTGTCCCCTGTTCAAAAAGAGGGACGTTCAAAAGTAA
GATATCTGTAAAGGAAAAAAAAAGTACTTAATTAAATAAT
TATAACCATCAAAAA

lmo4a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lmo4a-201 1895
ncRNA lmo4a-002 (1) 615
lmo4a-003 (1) 538
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo4a-201 Contained in:
[BAC] DKEY-2N12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000023185 (1),  Ensembl_Trans:ENSDART00000085219 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC045835 (1) 1927 nt
GenBank:AY028903 (1) 1849 nt
GenBank:CV110141 (1) 813 nt
GenBank:CK024817 (1) 777 nt
GenBank:BM103220 (1) 689 nt
GenBank:BQ618376 (1) 557 nt
GenBank:BQ618154 (1) 536 nt
GenBank:BQ419421 (1) 420 nt
CITATIONS (2)