header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6360
Transcript Name: lmo4a-002
Previous Name: lmo4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023186 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023186|OTTDARG00000018966|ZDB-GENE-010702-1 lmo4a|no_translation lmo4-002 LG_ CR855258.6 Danio rerio protein_coding KNOWN, 615 bp
TGCACCGCAGGTCTAAACGTTCTGCTTAGTTGGACGTTGC
TCTGACCTTCCCAAACCACAGCCTTCATGCTTATTTTAGA
CAATGTTAGAAAAGGTAATATGTCGGCCTGAAGCTAGACA
TCATAAAACTGTACTAGTGTGTGTGGTGACGAGGGTTTGT
GGTTCCACTGAATTCATCCTTCTGGAACTTCTGCATGAGG
CTGTTTATTGAGAGCGGGAATAGTGTGCTTGCTCGCAGGG
AAATGGCTGGTGAACAGTAACTCATCAAGGGAACACACTC
ATCATAAGTGAAAACATGCTCGAACTGAAATCATCAGACA
GGGAATGACAAATCAGCTGCACTTTCAATTGGAAAACATC
ATTAACAGTGGCAGGCAATGGTGAACAGTCGTGTGGAAAG
CTCCGCGGTTGCGGTAACAGGAGGCAGTGGTGGGGCCGTA
CGCTCCTGTGCTGGATGCGGTGGTCGGATATCGGACCGCT
TTCTGCTCTTCTCTATGGATCGGTACTGGCACACGCGCTG
CCTCAAGTGCTCCTGCTGCCAGGCTCAGCTGGGAGAGATC
GGCAGCACCTGCTTCAGCAAAGGAGGGATGATCCTCTGCA
GGAACGATTACATCA

lmo4a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA lmo4a-002 615
lmo4a-003 (1) 538
mRNA lmo4a-201 (1) 1895
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo4a-002 Contained in:
OTHER lmo4a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023186 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BG985854 (1) 627bp
    CITATIONS (1)