header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6361
Transcript Name: lmo4a-003
Previous Name: lmo4-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023187 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023187|OTTDARG00000018966|ZDB-GENE-010702-1 lmo4a|no_translation lmo4-003 LG_ CR855258.6 Danio rerio protein_coding KNOWN, 538 bp
TGGGGTGGATGAAAGCAAAACAAGTTTGAGGACAGCCACT
TTATCACTGTTTGATACCTCACAGTAACTTCTGAAGTGAT
TCCAGCACCCCTTGACCTTCGAGATACGTACAAATAACGG
CAGGCAATGGTGAACAGTCGTGTGGAAAGCTCCGCGGTTG
CGGTAACAGGAGGCAGTGGTGGGGCCGTACGCTCCTGTGC
TGGATGCGGTGGTCGGATATCGGACCGCTTTCTGCTCTTC
TCTATGGATCGGTACTGGCACACGCGCTGCCTCAAGTGCT
CCTGCTGCCAGGCTCAGCTGGGAGAGATCGGCAGCACCTG
CTTCAGCAAAGGAGGGATGATCCTCTGCAGGAACGATTAC
ATCAGGTACTAAAAGAAACAGGCAGTTGGGGGGTTTGGCG
GGACTGATGTAGAAAATGCTGAGTAAGAGTGAATAAATGA
TGTTCTCGGCTACAGAATCAGTCTTAACATTACACAAGCA
GGACAGGAAATCTGTGGATGGACTTGACTCAAACTAATAA
ATAATTTCTTTGTCTAGT

lmo4a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA lmo4a-002 (1) 615
lmo4a-003 538
mRNA lmo4a-201 (1) 1895
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo4a-003 Contained in:
OTHER lmo4a-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023187 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)