ZFIN ID: ZDB-TSCRIPT-090929-5054
Transcript Name: mef2aa-005
Previous Name: mef2a-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021362 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021362|OTTDARG00000013211|ZDB-GENE-990415-163 mef2aa|no_translation mef2a-005 LG_none AL953894.5,BX323877.4 Danio rerio protein_coding KNOWN, 606 bp
GAAAGACCCAGGGACGAGAGTGTGAAGTCAGGCCTCACAG
GGGCAAGAAGAAAGCCGTCCAAAGCCAGCTGGTCTGGCTT
TGAGGAAAGCAAAGAGAGACAGAAAGCACAAGAGAGATAG
AGAGAACGTGGAGGAGGAAGAAGAGAAGAGAGAATTAATT
TGATTGAAGGGAATTAAGAAAGTAATAGTGGCACACCTGG
GGAAGGCCTGAGCAGCAGGTTCTGTGAAGGGGATCGATCA
TCTCTACAGACAGGGCATTTTACCCGAGGAAGAGAAAGCA
CCAGGAAGCTCCAAGTCGAGAGAAGGCATTGAAAGCCAAG
GAAGAAAGAACGTAAATAAGCTGGATATTTTGGGTCCAGG
ACTGAGGATTGCGCCGCTTCGTTTGTTAGGGTCGTGGACA
CCTTGAGAAAGAGGCACAGACGGAAAGAGAGTGAGAGAGA
AAGACTCGAGAAGAAAGAGTGGAGTACAATGTGCTAGGAG
AGTGAAGGCAGACAAACTCTCGTGTTTTTCTGATATTCTC
GGGGTGTCAGAGAGACCAAGCAGGACGCCAAGATGGGACG
GAAGAAGATACAGATCACGCGGATCATGGATGAGAGGAAC
CGGCAG

mef2aa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mef2aa-201 (1)    Ensembl 1736
mef2aa-202 (1)    Ensembl 1844
mef2aa-204 (1)    Ensembl 1733
mef2aa-205 (1)    Ensembl 2113
ncRNA mef2aa-005 606
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mef2aa-005 Contained in:
[BAC] CH211-212B13 (1), DKEYP-96F6 (1)

Genome Resources: Vega_Trans:OTTDART00000021362 (1),  Ensembl_Trans:ENSDART00000143977 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AI722103 (1) 610 nt
CITATIONS (2)