ZFIN ID: ZDB-TSCRIPT-090929-3143
Transcript Name: mef2aa-205
Previous Names: mef2a-001, mef2aa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015660 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015660|OTTDARG00000013211|ZDB-GENE-990415-163 mef2aa|OTTDARP00000013312 mef2a-001 LG_none AL953894.5,BX323877.4 Danio rerio protein_coding KNOWN, 2113 bp
ATGTTGTGACAAGAGCGACTGCTGCTTCTTCTGAGTTTGT
CAGCTCAGCTCCCGAAAATAGAAGCCGTGTGTCAATGTGA
CTGAAAATACATTTATGTCACAGTGTATCCACGGGAGTCA
CTGATACACAGTATCTATATACAGCGAGGGGGACCACGGA
GAAAAAAGGGCATTTTACCCGAGGAAGAGAAAGCACCAGG
AAGCTCCAAGTCGAGAGAAGGCATTGAAAGCCAAGGAAGA
AAGAACGTAAATAAGCTGGATATTTTGGGTCCAGGACTGA
GGATTGCGCCGCTTCGTTTGTTAGGGTCGTGGACACCTTG
AGAAAGAGGCACAGACGGAAAGAGAGTGAGAGAGAAAGAC
TCGAGAAGAAAGAGTGGAGTACAATGTGCTAGGAGAGTGA
AGGCAGACAAACTCTCGTGTTTTTCTGATATTCTCGGGGT
GTCAGAGAGACCAAGCAGGACGCCAAGATGGGACGGAAGA
AGATACAGATCACGCGGATCATGGATGAGAGGAACCGGCA
GGTTACCTTCACGAAGCGGAAGTTTGGTTTGATGAAGAAA
GCTTATGAGCTGAGCGTATTGTGTGACTGTGAGATTGCCC
TGATTATATTCAACAGCTCGAACAAACTCTTTCAGTATGC
CAGCACTGACATGGACAAAGTCCTACTTAAGTACACAGAA
TACAATGAACCCCACGAGAGCAGAACCAACTCTGACATTG
TAGAGAAATTAAGAAACAAAGGCCATAATGACTGTCCCAG
TCCCGATCCAGATGACTGTTTCGGTCACAGTCCCCTCATG
GACGACCGTTTCGGCAAACTAAACGAAGAGAGTGATTTAA
TGTACAAGCGCTGTGGTCCGACGGCCTTGCCCCCGCAAAA
CTTCTCCATGCATGTGGCTGTGCCAGTGACGAACCCCAAC
GCCATGTCCTACAACCCTGGGGCTTCTCTGAGCAGCCAGA
GCCTGTCGGCCGCTGCCTCTCTGAGTGACGGTGCCATGCT
GTCTCCACCTCAAGGTTCAATGCACAGAAGCGTAGTGCCC
CCACAGAGACCCCCCAGCACAGGCAGCACAGGAAACGGCT
TCGTTAACCCGAGGGGCTCGCCGGGGCTTCTGGGTACACC
CAGCGGGAACGGACTTGGTAAAGTCATGCCTGCGAAGTCA
CCGCCACCACCGGGAGGCAACATGGGCATCGGCAGCCGCA
AGCCAGACTTGAGAGTCGTCATCCCCCCATCCAGCAAGGG
CATGATGCCACCCCTGAACACCCAGAGGATAAGCAGTTCC
CAGTCGACTCAGCCTCTCGCCACACCGGTGGTCTCCGTCA
CCACCCCAAGTTTGGCACCTCAAGGCCTGGTCTACTCAGG
CATGCCCACTGCCTACAACTCTGAATACTCCCTGAGCAGT
GCTGAGCTCTCCTCTCTGCAAGGCTTTGGCTCTCCAGGGC
TCTCTATAGGCTCAGTGTCGGCATGGCAACAGCATCAACT
GGGCCAGGCAGCTCTCAGCTCGCTGGTAGGTGGCGGTCAC
TTACCTCAGGGCTCAAACCTCTCCATCAACACCAGCCAGA
ATGTCAACATTAAATCAGAGCCCATCTCTCCTCCACGCGA
GCGTGTAACCCCATCTGGTTTCCCACCACAGCAGCAGCAG
CCTCCCTCTGGCCGTCCTGACATGGGCCGCTCACCCGTTG
ACAGCCTCAGCTCCTCCTGCTCCTCCTACGATGGCAGCGA
CCGAGAGGATCACCGGCCAGATTTCCACTCCCCGCTTGGC
CTGGGTCGACCTCCAGCCGGTGGGGCAGACGAGAGGGAGA
GTCCATCAGTCAAGCGCATGCGCATGGACACCTGGGTGAC
ATAAAGCTGTCCGAAAGCCGACAGCCAGTCAGTCACACAC
AGGGCTGGGCAGGGGGAAAGGGAGAGAGAGAGGTTTGACA
GCAGGGAGGGTCATTATTGTTGTTATTATTATATTCTATT
GTTATAATTTAACGTCATTTCACTTTTTTTTGTAAGTAGG
TGGACGGGGAAAGAAATCGAAAATGTCCTGACATATCGAA
ATTTAGCAGATGAGTGGAGAGAGAGAGAGAAATCTCAAGT
CGAGCAGTCAGAATAAATGGTGTACTCAAAAAA

mef2aa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mef2aa-201 (1)    Ensembl 1736
mef2aa-202 (1)    Ensembl 1844
mef2aa-204 (1)    Ensembl 1733
mef2aa-205 2113
ncRNA mef2aa-005 (1)    Ensembl 606
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mef2aa-205 Contained in:
[BAC] CH211-212B13 (1), DKEYP-96F6 (1)

Genome Resources: Vega_Trans:OTTDART00000015660 (1),  Ensembl_Trans:ENSDART00000148106 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC044337 (1) 2131 nt
GenBank:DT873463 (1) 908 nt
GenBank:CN319884 (1) 866 nt
GenBank:BI876223 (1) 727 nt
GenBank:BI706188 (1) 571 nt
CITATIONS (2)