ZFIN ID: ZDB-TSCRIPT-090929-3144
Transcript Name: mef2aa-201
Previous Names: mef2a-002, mef2aa-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015661 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015661|OTTDARG00000013211|ZDB-GENE-990415-163 mef2aa|OTTDARP00000013313 mef2a-002 LG_none AL953894.5,BX323877.4 Danio rerio protein_coding KNOWN, 1736 bp
ATGGGACGGAAGAAGATACAGATCACGCGGATCATGGATG
AGAGGAACCGGCAGGTTACCTTCACGAAGCGGAAGTTTGG
TTTGATGAAGAAAGCTTATGAGCTGAGCGTATTGTGTGAC
TGTGAGATTGCCCTGATTATATTCAACAGCTCGAACAAAC
TCTTTCAGTATGCCAGCACTGACATGGACAAAGTCCTACT
TAAGTACACAGAATACAATGAACCCCACGAGAGCAGAACC
AACTCTGACATTGTAGAGGCGCTTAACAAGAAAGAACACA
GAGGCTGTGATAGCCCGGATCCTGATGCCTCATATGTCCT
CACCCCTCACACAGAAGAAAAATATAAAAAAATTAATGAA
GAGTTTGATAATATGATGCGAAATCATAAAATCCCGACGG
CCTTGCCCCCGCAAAACTTCTCCATGCATGTGGCTGTGCC
AGTGACGAACCCCAACGCCATGTCCTACAACCCTGGGGCT
TCTCTGAGCAGCCAGAGCCTGTCGGCCGCTGCCTCTCTGA
GTGACGGTGCCATGCTGTCTCCACCTCAAGGTTCAATGCA
CAGAAGCGTAGTGCCCCCACAGAGACCCCCCAGCACAGGC
AGCACAGGTGACATGCTGCGTACCCTCACCGAGCTCACAG
TGCCGAGCGGTGTCGACTCCAGCCCCGCGGGAAACGGCTT
CGTTAACCCGAGGGGCTCGCCGGGGCTTCTGGGTACACCC
AGCGGGAACGGACTTGGTAAAGTCATGCCTGCGAAGTCAC
CGCCACCACCGGGAGGCAACATGGGCATCGGCAGCCGCAA
GCCAGACTTGAGAGTCGTCATCCCCCCATCCAGCAAGGGC
ATGATGCCACCCCTGTCAGAGGAGGAAGAGATGGAGTTGA
ACACCCAGAGGATAAGCAGTTCCCAGTCGACTCAGCCTCT
CGCCACACCGGTGGTCTCCGTCACCACCCCAAGTTTGGCA
CCTCAAGGCCTGGTCTACTCAGGCATGCCCACTGCCTACA
ACTCTGAATACTCCCTGAGCAGTGCTGAGCTCTCCTCTCT
GCAAGGCTTTGGCTCTCCAGGGCTCTCTATAGGCTCAGTG
TCGGCATGGCAACAGCATCAACTGGGCCAGGCAGCTCTCA
GCTCGCTGGTAGGTGGCGGTCACTTACCTCAGGGCTCAAA
CCTCTCCATCAACACCAGCCAGAATGTCAACATTAAATCA
GAGCCCATCTCTCCTCCACGCGAGCGTGTAACCCCATCTG
GTTTCCCACCACAGCAGCAGCAGCCTCCCTCTGGCCGTCC
TGACATGGGCCGCTCACCCGTTGACAGCCTCAGCTCCTCC
TGCTCCTCCTACGATGGCAGCGACCGAGAGGATCACCGGC
CAGATTTCCACTCCCCGCTTGGCCTGGGTCGACCTCCAGC
CGGTGGGGCAGACGAGAGGGAGAGTCCATCAGTCAAGCGC
ATGCGCATGGACACCTGGGTGACATAAAGCTGTCCGAAAG
CCGACAGCCAGTCAGTCACACACAGGGCTGGGCAGGGGGA
AAGGGAGAGAGAGAGGTTTGACAGCAGGGAGGGTCATTAT
TGTTGTTATTATTATATTCTATTGTTATAATTTAACGTCA
TTTCACTTTTTTTTGTAAGTAGGTGGACGGGGAAAGAAAT
CGAAAATGTCCTGACATATCGAAATTTAGCAGATGAGTGG
AGAGAGAGAGAGAAATCTCAAGTCGAGCAGTCAGAATAAA
TGGTGTACTCAAAAAA

mef2aa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mef2aa-201 1736
mef2aa-202 (1)    Ensembl 1844
mef2aa-204 (1)    Ensembl 1733
mef2aa-205 (1)    Ensembl 2113
ncRNA mef2aa-005 (1)    Ensembl 606
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mef2aa-201 Contained in:
[BAC] CH211-212B13 (1), DKEYP-96F6 (1)

Genome Resources: Vega_Trans:OTTDART00000015661 (1),  Ensembl_Trans:ENSDART00000005740 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)