header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3577
Transcript Name: ottdart00000016889
Previous Name: cyt1-007

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016889 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016889|OTTDARG00000014151|ZDB-GENE-991008-6 cyt1|no_translation cyt1-002 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 1663 bp
ACTCATCCGCTCACTCCTTCTCCAGGCAGAGCAGACGACG
ACAGCAAGACTCCTTCAAAATGATGTCTTCTTCATCCATC
CGCATGTCCTCAGGAGGATCTTCTCGCCTCTCTGTCGGTG
GTGGAGCCAGTCGTGTCTCAGGAGTGCGTGCTGGTAGTGT
CTATGGAGGAGCAGGAGGATCCGGTGTTCGCATCTCCAGT
TCTTCTGCTTCCAGATCCTACTCTGCTGGTGGGGGCGCAG
GATTTGGTGGTGGTGCTGGTGCTGGCTTCAACCTGTCTGA
TGCCATTGACGTGCCAACAAATGAGAAAGCCACCATGCAA
AACCTCAATGACCGTCTGGCCTCCTACCTGGAGAAGGTGC
GCAGCCTGGAGAAGGCCAATGCAGATCTTGAGCTGAAGAT
CCGCCAGTTCCTGGACAGCAAGGCCACGCCTAATGCTCGT
GACTACAGTGCCTACTATGCAACAATCAGTGACCTCCAGG
CAAAGATCCTGCATGCTACTGGTGTAAATGGAGGCATCTA
CCTCAGCATTGACAATGCCAAGCTGGCTGCAGATGACTTC
AGAGTCAAGTATGAGAATGAGCTGAGCATGAGGCAGTCTG
TGGAAGCAGACATTGTTGGCTTGAGGAAGGTGCTGGATGA
GCTCACAATGACCAGATCTGACCTGGAGTTGCAGATCGAG
GGTCTGAAAGAAGAACTGATCTTCCTCAAGAAGAACCACG
AGGAGGAGCTCTTGGCAGCACGCACCCAGATGAGTGGACA
AGTCAATGTAGAGGTCGATGCAGCACCACAGGAAGACCTG
ACAAAGATCTTGGCTGATATCCGTGAGCACTACGAGGCAG
TTTCTGCCAAGAACCGTAAAGATCTTGAGAGTTGGTTCCA
GGCCAAGGTAAAAATCTGTTTTAACATGTCAAATTTGTTT
AGCAAGATGGAAATCAAAACCAACAGATGACTTATCTAGC
TGCTTTTCTGTTGCATTTCCTCTCACAGAGTGAGTCCCTC
AACAAGGAAGTTGCTGTAAGCACAGAAACTCTCCAAACCT
CCCGCTCTGAAATCACAGAGGTTAAGCGCACACTCCAGAG
TCTTGAAATCGAACTACAGTCACAACTCAGCATGAAAGCG
TCATTGGAAGGCACTCTGGCAGACACACAGGCCCGCTACA
CCAACATGTTGAATGGTTACCAGTTCCAGGTGAGCAGCCT
GGAAGAGCAACTGATACAGCTCCGTGCTGATCTGGAGCGC
CAAGGTCAAGAGTACCAGATGCTTCTGGACATCAAGACCA
GACTGGAGATGGAGATTGCAGAGTACAGAAGACTGCTGGA
TGGAGAGGCTACTACTGTTTCCACAAGCTCAAGCACTACA
CGCAAAGTGGTAACCATTGTGGAAGAGGTGGTGGATGGAA
AAGTGGTCAGCTCATCCTCCAAGGCCACAACCGAGACTAA
AACCACTTAAAAGAAATCTTGACAAAAAGAGTTCTCAATC
AGTGTGATAAGAAAACCAATAAACTGGTCTCACTGTGAAT
TTTTGTACTGGTCTTGTTTTGGGGAACATGATTTATACCA
TGTATAAAAGCAACCCATATTATAATAAATATGAAAATTA
GTTTATTAATAGCAGAGTAAGTTTGCCAATTAGAAGCATA
ATAGAAACAAATGATTTGTAAAA

cyt1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cyt1-201 (1) 1572
aberrant processed transcript cyt1-202 (1) 787
ncRNA ottdart00000016889 1663
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000016889 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER ottdart00000016889 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016889 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CB366023 (1) 490bp
    GenBank:BE557276 (1) 429bp
    CITATIONS (1)