header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3571
Transcript Name: cyt1-201
Previous Name: cyt1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016883 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016883|OTTDARG00000014151|ZDB-GENE-991008-6 cyt1|OTTDARP00000014312 cyt1-001 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 1572 bp
TCTTCTCCTCACTCATCCGCTCACTCCTTCTCCAGGCAGA
GCAGACGACGACAGCAAGACTCCTTCAAAATGATGTCTTC
TTCATCCATCCGCATGTCCTCAGGAGGATCTTCTCGCCTC
TCTGTCGGTGGTGGAGCCAGTCGTGTCTCAGGAGTGCGTG
CTGGTAGTGTCTATGGAGGAGCAGGAGGATCCGGTGTTCG
CATCTCCAGTTCTTCTGCTTCCAGATCCTACTCTGCTGGT
GGGGGCGCAGGATTTGGTGGTGGTGCTGGTGCTGGCTTCA
ACCTGTCTGATGCCATTGACGTGCCAACAAATGAGAAAGC
CACCATGCAAAACCTCAATGACCGTCTGGCCTCCTACCTG
GAGAAGGTGCGCAGCCTGGAGAAGGCCAATGCAGATCTTG
AGCTGAAGATCCGCCAGTTCCTGGACAGCAAGGCCACGCC
TAATGCTCGTGACTACAGTGCCTACTATGCAACAATCAGT
GACCTCCAGGCAAAGATCCTGCATGCTACTGGTGTAAATG
GAGGCATCTACCTCAGCATTGACAATGCCAAGCTGGCTGC
AGATGACTTCAGAGTCAAGTATGAGAATGAGCTGAGCATG
AGGCAGTCTGTGGAAGCAGACATTGTTGGCTTGAGGAAGG
TGCTGGATGAGCTCACAATGACCAGATCTGACCTGGAGTT
GCAGATCGAGGGTCTGAAAGAAGAACTGATCTTCCTCAAG
AAGAACCACGAGGAGGAGCTCTTGGCAGCACGCACCCAGA
TGAGTGGACAAGTCAATGTAGAGGTCGATGCAGCACCACA
GGAAGACCTGACAAAGATCTTGGCTGATATCCGTGAGCAC
TACGAGGCAGTTTCTGCCAAGAACCGTAAAGATCTTGAGA
GTTGGTTCCAGGCCAAGAGTGAGTCCCTCAACAAGGAAGT
TGCTGTAAGCACAGAAACTCTCCAAACCTCCCGCTCTGAA
ATCACAGAGGTTAAGCGCACACTCCAGAGTCTTGAAATCG
AACTACAGTCACAACTCAGCATGAAAGCGTCATTGGAAGG
CACTCTGGCAGACACACAGGCCCGCTACACCAACATGTTG
AATGGTTACCAGTTCCAGGTGAGCAGCCTGGAAGAGCAAC
TGATACAGCTCCGTGCTGATCTGGAGCGCCAAGGTCAAGA
GTACCAGATGCTTCTGGACATCAAGACCAGACTGGAGATG
GAGATTGCAGAGTACAGAAGACTGCTGGATGGAGAGGCTA
CTACTGTTTCCACAAGCTCAAGCACTACACGCAAAGTGGT
AACCATTGTGGAAGAGGTGGTGGATGGAAAAGTGGTCAGC
TCATCCTCCAAGGCCACAACCGAGACTAAAACCACTTAAA
AGAAATCTTGACAAAAAGAGTTCTCAATCAGTGTGATAAG
AAAACCAATAAACTGGTCTCACTGTGAATTTTTGTACTGG
TCTTGTTTTGGGGAACATGATTTATACCATGTATAAAAGC
AACCCATATTATAATAAATATGAAAATTAGTTTATTAATA
GCAGAGTAAGTTTGCCAATTAGAAGCATAATAGAAACAAA
TGATTTGTAAAA

cyt1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cyt1-201 1572
aberrant processed transcript cyt1-202 (1) 787
ncRNA ottdart00000016889 (1) 1663
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyt1-201 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER cyt1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016883 (1)
  • Ensembl_Trans:ENSDART00000004812 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF197880 (1) 1426bp
    GenBank:AF084461 (1) 1403bp
    GenBank:CK025607 (1) 1110bp
    GenBank:CA469825 (1) 927bp
    GenBank:BQ259433 (1) 624bp
    GenBank:CB363932 (1) 567bp
    GenBank:AW595411 (1) 502bp
    GenBank:AL906486 (1) 459bp
    GenBank:AI436887 (1) 224bp
    CITATIONS (2)