ZFIN ID: ZDB-TSCRIPT-090929-3574
Transcript Name: cyt1-202
Previous Name: cyt1-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016886 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016886|OTTDARG00000014151|ZDB-GENE-991008-6 cyt1|OTTDARP00000041848 cyt1-004 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 787 bp
ACTCATCCGCTCACTCCTTCTCCAGGCAGAGCAGACGACG
ACAGCAAGACTCCTTCAAAATGATGTCTTCTTCATCCATC
CGCATGTCCTCAGGAGGATCTTCTCGCCTCTCTGTCGGTG
GTGGAGCCAGTCGTGTCTCAGGAGTGCGTGCTGGTAGTGT
CTATGGAGGAGCAGGAGGATCCGGTGTTCGCATCTCCAGT
TCTTCTGCTTCCAGATCCTACTCTGCTGGTGGGGGCGCAG
GATTTGGTGGTGGTGCTGGTGCGCAGCCTGGAGAAGGCCA
ATGCAGATCTTGAGCTGAAGATCCGCCAGTTCCTGGACAG
CAAGGCCACGCCTAATGCTCGTGACTACAGTGCCTACTAT
GCAACAATCAGTGACCTCCAGGCAAAGATCCTGCATGCTA
CTGGTGTAAATGGAGGCATCTACCTCAGCATTGACAATGC
CAAGCTGGCTGCAGATGACTTCAGAGTCAAGTATGAGAAT
GAGCTGAGCATGAGGCAGTCTGTGGAAGCAGACATTGTTG
GCTTGAGGAAGGTGCTGGATGAGCTCACAATGACCAGATC
TGACCTGGAGTTGCAGATCGAGGGTCTGAAAGAAGAACTG
ATCTTCCTCAAGAAGAACCACGAGGAGGAGCTCTTGGCAG
CACGCACCCAGATGAGTGGACAAGTCAATGTAGAGGTCGA
TGCAGCACCACAGGAAGACCTGACAAAGATCTTGGCTGAT
ATCCGTGAGCACTACGAGGCAGTTTCTGCCAAGAACCGTA
AAGATCTTGAGAGTTGGTTCCAGGCCA

cyt1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cyt1-201 (1) 1572
aberrant processed transcript cyt1-202 787
ncRNA ottdart00000016889 (1) 1663
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyt1-202 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER cyt1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016886 (1)
  • Ensembl_Trans:ENSDART00000133032 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT865715 (1) 780bp
    GenBank:CB357729 (1) 500bp
    CITATIONS (2)