header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21470
Transcript Name: ptprdb-203
Previous Names: ptprdb-003, zgc:165626-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041418 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041418|OTTDARG00000027112|ZDB-GENE-070615-38 ptprdb|OTTDARP00000033085 DKEYP-118A3.1-003 LG_none BX629341.9,BX546494.9 Danio rerio protein_coding KNOWN, 957 bp
ATCAAAAAGCGAGACCTGCGAGCTCTTTACGAGCGCTGGA
AACACGCAGTGCTTTTGCCGCTGTTGTGCTTTTTATAGTT
CAGCCCAGCACCGGTGAACATCAGAAGGGAGAGGACTGGC
TTCTGGATTATTTTTGTGCTGCTTATAGATGAATTTACAG
GCGGGACCGAGCCGGTGAGACCCGAATGAAAACCTGAACC
CGACAGCGATGTTGATCAGGTTATGAGTGCACTTACAGCT
TGGTGATCCACAAACACAGACAAGCCAATGAGAGGATGGC
CAGAGGTCACATGATCTACAGAAGCGCCTACCAGCCGGTA
CTACTGATTCTACTGAGCGCGCTCCAGCTGGCGCATATGC
AATCTGCTCCTCGCTTCACTCGAACTCCCACTGATCAGAT
AGGAGTTCAGGGCGGCGTCGCCTCCTTCGTCTGTCAGGCC
ACTGGAGACCCACAACCCAAAATCACATGGAGCAGAAAAG
GCAAAAAAGTCACCAACCAGAGATTTGAGGTGATAGAGTT
TGAGGATGGCTCAGGGTCTGCGTTGCGAGTGCAGCCGCTT
CGAACCCCCCGTGACGAGGCTATTTATGAATGTGTTGCTT
CTAATGAAATTGGGGAGATCACCGCCTCTACGCGTCTTAG
CGTTCTCCGCGAGGACCAGCTCCCTGCGGGCTTTCCATCT
ATAGACATGGGCCCTCAGCTGAAGGTGGTGGAGCGGTCTC
GCACCGCTACCATGCTGTGTGCAGCCAGCGGGACGCCTGA
CCCCGAAATCACCTGGTTTAAAGATTTCCTGCCCATTGAC
ACACACACTCACGGCCGCATCAAACAGCTGCGCTCAGGTG
TGTGCGCTGAAGGAGTCACGCTCTCTCGGCTCTTATTCTC
CTCATTTGTTTAAAGGTGCACTTAAGAAATGTCCAGCACA
CATTTAATGGACATAATTTACATATATTTCTAAAAGG

ptprdb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ptprdb-201 (1) 1140
ptprdb-202 (1) 6806
ptprdb-203 957
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptprdb-203 Contained in:

OTHER ptprdb-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041418 (1)
  • Ensembl_Trans:ENSDART00000143663 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH447434 (1) 966 bp
    CITATIONS (2)