header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21469
Transcript Name: ptprdb-201
Previous Names: ptprdb-002, zgc:165626-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041417 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041417|OTTDARG00000027112|ZDB-GENE-070615-38 ptprdb|OTTDARP00000033084 DKEYP-118A3.1-002 LG_none BX629341.9,BX546494.9 Danio rerio protein_coding KNOWN, 1140 bp
AAATTAATATACAAAAAGCGTCTGGTTGTCTCAGCTAAGG
TTATGAGTGCACTTACAGCTTGGTGATCCACAAACACAGA
CAAGCCAATGAGAGGATGGCCAGAGGTCACATGATCTACA
GAAGCGCCTACCAGCCGGTACTACTGATTCTACTGAGCGC
GCTCCAGCTGGCGCATATGCAATCTGCTCCTCGCTTCACT
CGAACTCCCACTGATCAGATAGGAGTTCAGGGCGGCGTCG
CCTCCTTCGTCTGTCAGGCCACTGGAGACCCACAACCCAA
AATCACATGGAGCAGAAAAGGCAAAAAAGTCACCAACCAG
AGATTTGAGGTGATAGAGTTTGAGGATGGCTCAGGGTCTG
CGTTGCGAGTGCAGCCGCTTCGAACCCCCCGTGACGAGGC
TATTTATGAATGTGTTGCTTCTAATGAAATTGGGGAGATC
ACCGCCTCTACGCGTCTTAGCGTTCTCCGCGAGGACCAGC
TCCCTGCGGGCTTTCCATCTATAGACATGGGCCCTCAGCT
GAAGGTGGTGGAGCGGTCTCGCACCGCTACCATGCTGTGT
GCAGCCAGCGGGACGCCTGACCCCGAAATCACCTGGTTTA
AAGATTTCCTGCCCATTGACACACACACTCACGGCCGCAT
CAAACAGCTGCGCTCAGGTGTGTGCGCTGAAGGAGTCACG
CTCTCTCGGCTCTTATTCTCCTCATTTGTTTAAAGGTGCA
CTTAAGAAATGTCCAGCACACATTTAATGGACATAATTTA
CATATATTTCTAAAAGGATGTGTCTTACTTTTATGAGATT
AAAAGTCATTTTTCTGTAGCTTTATACTCGATGAATCAGG
ATGGTCCCTCATTATGGTCACATGATCTGAGTTTTGCAGA
CTCTACTAATAACCATGAAATGTGTAATTCAGCCACATGA
ACCATTAGGGATTGACCAATATTAAAATTCTGGCTATTGT
AATCATTATGCTGATTCATTTTTTTCATATTGTGCCAAAA
ATATGTATTATTTTCATTTTAGTCTAGGAAAAACAAATTA
CGTTCATTATGAAAAAATCATTAGATGGTTAATGAAGTAT
ATGAAGTATTGAAGTAAATTTTGATTATGAAGTATAACAA
CAGCAAAAAAAAAAAAAAAA

ptprdb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ptprdb-201 1140
ptprdb-202 (1) 6806
ptprdb-203 (1) 957
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptprdb-201 Contained in:

OTHER ptprdb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041417 (1)
  • Ensembl_Trans:ENSDART00000127145 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC142910 (1) 1142 bp
    GenBank:EH473278 (1) 848 bp
    GenBank:EH483149 (1) 824 bp
    GenBank:DV598109 (1) 793 bp
    CITATIONS (2)