Transcript

ptprdb-202

ID
ZDB-TSCRIPT-090929-16814
Name
ptprdb-202
Previous Names
  • ptprdb-001
  • zgc:165626-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036312 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036312|OTTDARG00000027112|ZDB-GENE-070615-38 ptprdb|OTTDARP00000029141 DKEYP-118A3.1-001 LG_none BX629341.9,BX546494.9 Danio rerio protein_coding KNOWN, 6806 bp
GATCGCGCGCTCGGCTGCACACACAGCATCAGCATCATCA
AAAAGCGAGACCTGCGAGCTCTTTACGAGCGCTGGAAACA
CGCAGTGCTTTTGCCGCTGTTGTGCTTTTTATAGTTCAGC
CCAGCACCGGTGAACATCAGAAGGGAGAGGACTGGCTTCT
GGATTATTTTTGTGCTGCTTATAGATGAATTTACAGGCGG
GACCGAGCCGGTGAGACCCGAATGAAAACCTGAACCCGAC
AGCGATGTTGATCAGGTTATGAGTGCACTTACAGCTTGGT
GATCCACAAACACAGACAAGCCAATGAGAGGATGGCCAGA
GGTCACATGATCTACAGAAGCGCCTACCAGCCGGTACTAC
TGATTCTACTGAGCGCGCTCCAGCTGGCGCATATGCAATC
TGCTCCTCGCTTCACTCGAACTCCCACTGATCAGATAGGA
GTTCAGGGCGGCGTCGCCTCCTTCGTCTGTCAGGCCACTG
GAGACCCACAACCCAAAATCACATGGAGCAGAAAAGGCAA
AAAAGTCACCAACCAGAGATTTGAGGTGATAGAGTTTGAG
GATGGCTCAGGGTCTGCGTTGCGAGTGCAGCCGCTTCGAA
CCCCCCGTGACGAGGCTATTTATGAATGTGTTGCTTCTAA
TGAAATTGGGGAGATCACCGCCTCTACGCGTCTTAGCGTT
CTCCGCGAGGACCAGCTCCCTGCGGGCTTTCCATCTATAG
ACATGGGCCCTCAGCTGAAGGTGGTGGAGCGGTCTCGCAC
CGCTACCATGCTGTGTGCAGCCAGCGGGACGCCTGACCCC
GAAATCACCTGGTTTAAAGATTTCCTGCCCATTGACACAC
ACACTCACGGCCGCATCAAACAGCTGCGCTCAGGTGCACT
TCAGATTGATCAGAGTGAAGAAACTGATCAGGGTAAATAC
GAGTGTGTCGCAACCAACAGTGAAGGAACACGCTACTCAA
CACCAGCTAACCTTTACGTCAGAGTGCGGCGAATCCCTCC
TCGATTCTCTGTGCCACCGATGGATTATGAGATCATGCCG
GGAGGAAGTGTGAACATCACCTGTCAGGCGGTGGGGGTTC
CTATGCCATATGTCAAATGGATGCTGGGAGCCGAGGATTT
GACACCAGAAGACGACATGCCTATTGGGCGAAATGTTCTG
GAGCTCACCAACGTACGCCAGTCTGCCAACTACACGTGTG
TCGCCATGTCTACACTCGGAGTTATAGAAACTGTTGCCCA
GATCACAGTTAAAGCTCTTCCCAATCCTCCAGGAAGTCCA
GTTGTAATGGAGCGATCTGCCACCAGCATTACTCTCATGT
GGGACAGTGGAAATCCACACCCTGTTTCTTACTACATCAT
CCAGTATCGTCCCTCCTCGTCCACCGACCCCTTCAAAGAA
ATTGATGCCATTGCAACAACCCGCTACAGTGTTGGTGGGC
TCAGCCCCTACTCCCACTACCATTTCCGGGTGGTGGCGGT
GAACTCAATCGGTCGCGGCGCACCGAGTCCAACCGTGGAT
GCTCGAACGGCGGAACAGGCACCCAGTTCCCCTCCTCGCC
GGGTCAGGGGTCGAATGCTGAGCGGATCCACAGCCATGGT
GCAATGGGAGGAGCCAGAGGAAGCCAACGGCCAGGTGGTT
GGTTACAGGGTCTATTACACATCAGATTCATCGCTTTCTG
TCAGCCAATGGGAGAAGGAGATGGTTCGAGGGGCCAATTT
TTTGAACATACGAGACTTGACCCCCAACAAAACCTATTAT
ATTAGAGTTCTCGCCTTCACCGCAGTCGGAGATGGACCTC
TTTCCAGTGATTTGCACATCATTGCTAAAACAGGAGTCCC
GTCGCAACCCACCGAGCTGAAGGCAGAGGTGAAATCAGAG
ACCAGCATCCTTCTGTCGTGGATCCCTCCCGCTCACAGTG
GCACAGATGCCATCACTGGCTATGAGCTCATTTACAGACT
TGGAGACCAGCCAGAGCAGAAAATAACATTTGATCCAAGC
TCCAGTTATCTGCTGAAGAATCTGAAGCCGTTTTCCACCT
ACGTATTTCAGCTAGCAGCGCGCAGTAAACACGGCCTGGG
GGCTTTTACAAGTGAAATCACCGTTCAGACTCCACAAACA
CAATCCATACCCCCTCCTCAGGACGTAACTTGCACAAGCC
CCTCCTCCACAAGTCTGCTTCTCAGCTGGGCCTCGCCCCC
CACTGATGAAAATGGGATTGTTACTGGGTACTCCATCCGA
TATGTGGCAGTTGAACGGGACAAAGACCCTGTTCAAAAGA
TCTCAGACATCCCGTCTAATTGTTTCCGATATCGAATCGA
GGGACTGAAGAAAGGGACCTTGTACTCTGTGACCATCGCT
GCCCACACTGACAATGGTCAAGGGCCTGAAAGCCTGCCGA
TATTGGTCCGCACAGAGGAAGACGTGCCCAGCGCACCGCC
GCGGGGTGTGGATGTGGTGGTCTTAAACGCCACCTCTGCC
AGAGTGTCATGGAAACCTCCGGTTGCTGAGCGACAGCATG
GAAAGATCCGTGGTTTCCAGGTGACATACGCCAGACGAAC
TGCAGGGGAGAGAACAGTTTCGCCCAGAATCAGGGAACAC
CTACTGAGAGACCCACAGCAGCCGCAGAATGACTCAATAG
AACATGAAGTGATTTTGACCGATTTGTGGCCGAACACTGA
ATACTCTGTGACCGTGGCTGCATTCACCTCAAAAGGCGAT
GGAGCACGCAGCAAACCAATCGTCATCAGAACTAAACCAT
CATTGCCAGGTATGCCTCTGCTCACAGTGGTGTCATCAGA
AGATAGCACTGCCCTGCTAAAGTGGCAGCCTCCCCCTACC
GGACTGTCCCCTGTGCTGGGATACAGGCTCTCATACGGCC
AGGCCGACCCGTCCTCAGACACCTTTATGGTACAGGAGCT
GGACGCAGAGGAACGCTCCTACACAGTCTCATCTTTAAGC
GCAGGAGTGCTGTACGTCTTCCGCCTTGCGGCCCGCACTG
TATGGGGTTACGGTTCAAGTGCTCAAGTCACACTTCTAAT
CCCAAACGTGGTGCAAACAACCACCGATGGCATGATAACA
GACCCCATGACAACTGAGGGTCAAACCATGAGCGTACAGG
AAAACGTTCCAATTTTGGCAAACCTAACAGCCGAAAGCAT
CAACTCCTCATCTGCGATCCTGAGATGGGAGCGACCAAAA
AACTATGACGGGATTCAAGGTTACCGCGTGTGGTTCGCTG
TCACCTATAGTAATGGCACAGACATTGCCATGGAATCTGA
TGTTTCGGAAACCACAGTGGTTCTTCATGGCCTAAGGGCA
AATACTGAGTACGTGGCGAGAGTTTGCATGCTTAGCAAAC
AAGGCCCCGGGCCCTATAGTCTCCCCATTTCCATCAAAAC
ACAACCCGCAGAGGAAGTTTTTGCTGTGAACTTCAAAGTG
AAAGCTGCAATGAAGAGTTCAGTTCTGCTGACCTGGGAGT
CTCGAACCACCAGTAATAAAGCGCAGTCTCTCATCATCTC
ATATGGCGATGGCGAGAGTGTGGAGGTCGATGGGCGGCTC
GGGCAGAAGTTAGTGACTAAGCTAAAGCCTCAGTCTCTGT
ACAACTTTCTGTTAACCAGTAAATCCGACAGCACTGGAGG
CCTGCAGCACCGCACGGACGCCATGACGGCTCCAAACCTG
ATGACCAGGAAACCACAGCTGCTGGACAAGACCAGCTCGC
AGAGCATTGCCATTCTGCAGCTGCCCACTGTACAAGGCCA
GGCTAACGTCAGGGGTTTCTACATTTTGGTCGTTCCTTTG
AAAAGGCAGAGAGCAGGAAACTTCCAGAATATGTGGAGCG
ATCCAGACGAGATGAACCTCGATGAGCTGCTGAGGGAGAT
TAATGGCACCGGTCGCTCTGTGCGTTTACGGAGGCAGGCA
GAGGCAAAGCCTTACATCACTGCTCATTTCCAAAATCTTC
CTGCTGAATTTAAGTTAGGAGATGGACATGTGTATGGAGC
CTTCATGAACCGACCTCTGGTGAACGGACAGGAGTATGTG
TGCTTCGTACTGGCTATTCTCGAACTGGGCCAGAATACTG
TCTACTCCACAAGCCCATTCTCTGATGCGGTGCTCTTCTC
TGATGTGGAGCCACAGCCAATCGTAGATGAGGAGGAGGGA
CTTCTGTGGGTGGTTGGACCAGTGTTGGCCGTCATCTTCA
TCATCAGCATCGTCATCCTCATCCTCCTCTTTAAAAGCAA
ACCAGACAGGAAGCGGGCAGAGTTGGAGGGCAGGAAGTGC
AGCTTTCCCAGCAGCGGTAAAGCCATGAGTTCCCAGCATC
CATCTGACCCCGTGGAGCTGCGCAGAATCAACTTCCCAAC
GGCTGGCATGACCAGCCACCCGCCAGTGTCCGTCTCTGAA
CTGCCCGCTCACATAGAGAGGATGAAGGCCAATGACAGCC
TGAGGTTCTCTCAAGAGTATGAGTCTATTGATCCAGGGCA
GCAGTTCTCCTGGGAACATTCTAACCTTGAGATTAACAAG
CCAAAGAACAGATATGCCAACGTCATCGCCTACGACCACA
CCAGAGTCGCCCTCACCAACACTGATGGTGTTGCTGGTGG
TGACTACATTAATGCCAACTTCATAGATGGCTACCGCAGA
CAGGGTGCTTACATCGCCACCCAGGGGCCCATGCCAGACA
CGTTTAGTGACTTCTGGAGAATGGTGTGGGAACAACACAC
AGCGAATGTCATTATGATCACCAAACTTGAAGAGAAATCG
AGGAATAAGTGTGATCAGTATTGGCCCAGCAGAGGAACGG
AAACATACGGACTGATGCAGGTCTCTCTACTGGACACGGT
GGAGCTTGCAACCTACTGCGTCAGGACGTTTGCCCTCTTT
AAGAGTGGGAGTGGTGAGAAGCGGGAGGTCCGTCAGTTCC
AGTTTACAGCATGGCCAGATCAGGGGGTACCTGAACACCC
TACTCCCTTCCTGGCCTTCCTCAGACGGGTCAAAGCCTGC
AACCCCCCAGACGCTGGACCCATTGTGGTCCACTGCAGTG
CCGGTGTGGGCCGGACAGGCTGCTTCATTGTGATTGATGC
CATGCTGGAACGAGTGAAGCAAGAGAAGACGTTAGATATT
TACGGTCACGTGACTCTAATGCGCTCTCAGCGAAACTACA
TGGTGCAGACAGAGGAGCAGTATGTCTTTATTTATGAGGC
GCTGCTGGAGGCCGTTTCCTGCGGCAACACTGAAGTTCCG
GCCCGGAACCTGTACGCCTACATCCAGAGACTGTCACAGA
CGGAGCCGCCGGAGCACATCAGCGGAATGGAGCAGGAGTT
TAAACGGTTAGCTAATGCCAAAGCGCATAACTCCAGATTC
GTCAGTGCCAGCCTTCCATGCAATAAGTTCAAGAACCGGT
TGGTGAACATCATGCCATATGAGAGCACACGTGTGTGTCT
GCAGCCAATCAGAGGAGTGGAGGGATCTGACTACGTCAAT
GGCAGTTTTATAGACGGCTACAGGCAACAGAGGGCGTATA
TTGCGACTCAGGGGCCACTGGCAGAGACAGTTGAAGATTT
CTGGAGAATGCTTTGGGAACACAATTCTACTATAGTAGTT
ATGCTTACTAAACTCAGAGAAATGGGAAGGGAGAAATGTC
ATCAGTACTGGCCGTCTGACCGATCAGCCCGATACCAGTA
CTTTGTTGTGGATCCCATGGCGGAATACAACATGCCTCAG
TATATACTCCGAGAGTTTAAAGTCACAGACGCCAGGGATG
GACAATCCAGAACAGTCCGGCAGTTTCAGTTCACGGATTG
GCCAGAGCAGGGTGTGCCAAAATCTGGCGAAGGGTTCATT
GACTTCATTGGTCAAGTGCACAAAACAAAAGAACAGTTCG
GTCAGGATGGGCCAATCACAGTACACTGCAGTGCTGGCGT
TGGAAGGACAGGTGTATTTATCACTCTCAGTATAGTGTTG
GAGAGGATGCGTTATGAGGGAGTAGTCGATATCTTCCAGA
CTGTCAAAATGTTGCGAACTCAAAGACCAGCCATGGTGCA
GACAGAGGAGCAGTACCAGTTCTGCTATCGAGCAGGGCTG
GAATACCTGGGCAGTTTTGATCACTATGCAACATAAAACC
TTCCCCTGGACCAAGAGCCACCTCATCATCATCACCACCA
CCACAACATCACAGCGAGACCTGCGTCTGATCAATCCGAC
AGCTTCTTTCTGCTGCTCAAGAGTCTGTTTGATTCCTCCA
GACAGCACACAGTTTAACAGTCAGCCAGAGAGGTCAGCTG
CGATACTGCGTTGTCACCACAAATTGCAGCTCCAGTCATA
GAACTGAAAGTTGTCAAGTCATATTGGGACTGGAGGAAAT
CGGTATGTGCTGTCTGGACCGATTCAATAGACCAGTGAGA
CTCCGAAAGCATTAGAAGAGACAACAATCAAACAGTTGAA
TGCTACTTTATACTTGTCCGAATTTATGAACCACCAAACC
CCTCGCAAAAAAAACAACAGTCATGTTTATAACAGGATGC
AGTCCGAGTGTAGAGTTGCCACTGTTTTTAGTCACCAGTT
TGTATAACGGATCCACCAACTCACTTGTTTAAGTGATTCG
TACAAAATGAAATTCAACAACACAGCCTAAGTATTGGTGC
TTACGCCAGTTTCCTGTTTGTTTATCTGTAGCGCGCACAC
ACACACAAGCGTAGATATATACGTACAAATCTATCACAGA
TTTAAGACGAGAAAAAAGTAAGTTAAAATGGAGATTTGTC
TCAAAAGCTGTGCAATATTGAACGTGATTATTGATCGCAC
CTTCGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations