header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16814
Transcript Name: ptprdb-202
Previous Names: ptprdb-001, zgc:165626-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036312 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036312|OTTDARG00000027112|ZDB-GENE-070615-38 ptprdb|OTTDARP00000029141 DKEYP-118A3.1-001 LG_none BX629341.9,BX546494.9 Danio rerio protein_coding KNOWN, 6806 bp
GATCGCGCGCTCGGCTGCACACACAGCATCAGCATCATCA
AAAAGCGAGACCTGCGAGCTCTTTACGAGCGCTGGAAACA
CGCAGTGCTTTTGCCGCTGTTGTGCTTTTTATAGTTCAGC
CCAGCACCGGTGAACATCAGAAGGGAGAGGACTGGCTTCT
GGATTATTTTTGTGCTGCTTATAGATGAATTTACAGGCGG
GACCGAGCCGGTGAGACCCGAATGAAAACCTGAACCCGAC
AGCGATGTTGATCAGGTTATGAGTGCACTTACAGCTTGGT
GATCCACAAACACAGACAAGCCAATGAGAGGATGGCCAGA
GGTCACATGATCTACAGAAGCGCCTACCAGCCGGTACTAC
TGATTCTACTGAGCGCGCTCCAGCTGGCGCATATGCAATC
TGCTCCTCGCTTCACTCGAACTCCCACTGATCAGATAGGA
GTTCAGGGCGGCGTCGCCTCCTTCGTCTGTCAGGCCACTG
GAGACCCACAACCCAAAATCACATGGAGCAGAAAAGGCAA
AAAAGTCACCAACCAGAGATTTGAGGTGATAGAGTTTGAG
GATGGCTCAGGGTCTGCGTTGCGAGTGCAGCCGCTTCGAA
CCCCCCGTGACGAGGCTATTTATGAATGTGTTGCTTCTAA
TGAAATTGGGGAGATCACCGCCTCTACGCGTCTTAGCGTT
CTCCGCGAGGACCAGCTCCCTGCGGGCTTTCCATCTATAG
ACATGGGCCCTCAGCTGAAGGTGGTGGAGCGGTCTCGCAC
CGCTACCATGCTGTGTGCAGCCAGCGGGACGCCTGACCCC
GAAATCACCTGGTTTAAAGATTTCCTGCCCATTGACACAC
ACACTCACGGCCGCATCAAACAGCTGCGCTCAGGTGCACT
TCAGATTGATCAGAGTGAAGAAACTGATCAGGGTAAATAC
GAGTGTGTCGCAACCAACAGTGAAGGAACACGCTACTCAA
CACCAGCTAACCTTTACGTCAGAGTGCGGCGAATCCCTCC
TCGATTCTCTGTGCCACCGATGGATTATGAGATCATGCCG
GGAGGAAGTGTGAACATCACCTGTCAGGCGGTGGGGGTTC
CTATGCCATATGTCAAATGGATGCTGGGAGCCGAGGATTT
GACACCAGAAGACGACATGCCTATTGGGCGAAATGTTCTG
GAGCTCACCAACGTACGCCAGTCTGCCAACTACACGTGTG
TCGCCATGTCTACACTCGGAGTTATAGAAACTGTTGCCCA
GATCACAGTTAAAGCTCTTCCCAATCCTCCAGGAAGTCCA
GTTGTAATGGAGCGATCTGCCACCAGCATTACTCTCATGT
GGGACAGTGGAAATCCACACCCTGTTTCTTACTACATCAT
CCAGTATCGTCCCTCCTCGTCCACCGACCCCTTCAAAGAA
ATTGATGCCATTGCAACAACCCGCTACAGTGTTGGTGGGC
TCAGCCCCTACTCCCACTACCATTTCCGGGTGGTGGCGGT
GAACTCAATCGGTCGCGGCGCACCGAGTCCAACCGTGGAT
GCTCGAACGGCGGAACAGGCACCCAGTTCCCCTCCTCGCC
GGGTCAGGGGTCGAATGCTGAGCGGATCCACAGCCATGGT
GCAATGGGAGGAGCCAGAGGAAGCCAACGGCCAGGTGGTT
GGTTACAGGGTCTATTACACATCAGATTCATCGCTTTCTG
TCAGCCAATGGGAGAAGGAGATGGTTCGAGGGGCCAATTT
TTTGAACATACGAGACTTGACCCCCAACAAAACCTATTAT
ATTAGAGTTCTCGCCTTCACCGCAGTCGGAGATGGACCTC
TTTCCAGTGATTTGCACATCATTGCTAAAACAGGAGTCCC
GTCGCAACCCACCGAGCTGAAGGCAGAGGTGAAATCAGAG
ACCAGCATCCTTCTGTCGTGGATCCCTCCCGCTCACAGTG
GCACAGATGCCATCACTGGCTATGAGCTCATTTACAGACT
TGGAGACCAGCCAGAGCAGAAAATAACATTTGATCCAAGC
TCCAGTTATCTGCTGAAGAATCTGAAGCCGTTTTCCACCT
ACGTATTTCAGCTAGCAGCGCGCAGTAAACACGGCCTGGG
GGCTTTTACAAGTGAAATCACCGTTCAGACTCCACAAACA
CAATCCATACCCCCTCCTCAGGACGTAACTTGCACAAGCC
CCTCCTCCACAAGTCTGCTTCTCAGCTGGGCCTCGCCCCC
CACTGATGAAAATGGGATTGTTACTGGGTACTCCATCCGA
TATGTGGCAGTTGAACGGGACAAAGACCCTGTTCAAAAGA
TCTCAGACATCCCGTCTAATTGTTTCCGATATCGAATCGA
GGGACTGAAGAAAGGGACCTTGTACTCTGTGACCATCGCT
GCCCACACTGACAATGGTCAAGGGCCTGAAAGCCTGCCGA
TATTGGTCCGCACAGAGGAAGACGTGCCCAGCGCACCGCC
GCGGGGTGTGGATGTGGTGGTCTTAAACGCCACCTCTGCC
AGAGTGTCATGGAAACCTCCGGTTGCTGAGCGACAGCATG
GAAAGATCCGTGGTTTCCAGGTGACATACGCCAGACGAAC
TGCAGGGGAGAGAACAGTTTCGCCCAGAATCAGGGAACAC
CTACTGAGAGACCCACAGCAGCCGCAGAATGACTCAATAG
AACATGAAGTGATTTTGACCGATTTGTGGCCGAACACTGA
ATACTCTGTGACCGTGGCTGCATTCACCTCAAAAGGCGAT
GGAGCACGCAGCAAACCAATCGTCATCAGAACTAAACCAT
CATTGCCAGGTATGCCTCTGCTCACAGTGGTGTCATCAGA
AGATAGCACTGCCCTGCTAAAGTGGCAGCCTCCCCCTACC
GGACTGTCCCCTGTGCTGGGATACAGGCTCTCATACGGCC
AGGCCGACCCGTCCTCAGACACCTTTATGGTACAGGAGCT
GGACGCAGAGGAACGCTCCTACACAGTCTCATCTTTAAGC
GCAGGAGTGCTGTACGTCTTCCGCCTTGCGGCCCGCACTG
TATGGGGTTACGGTTCAAGTGCTCAAGTCACACTTCTAAT
CCCAAACGTGGTGCAAACAACCACCGATGGCATGATAACA
GACCCCATGACAACTGAGGGTCAAACCATGAGCGTACAGG
AAAACGTTCCAATTTTGGCAAACCTAACAGCCGAAAGCAT
CAACTCCTCATCTGCGATCCTGAGATGGGAGCGACCAAAA
AACTATGACGGGATTCAAGGTTACCGCGTGTGGTTCGCTG
TCACCTATAGTAATGGCACAGACATTGCCATGGAATCTGA
TGTTTCGGAAACCACAGTGGTTCTTCATGGCCTAAGGGCA
AATACTGAGTACGTGGCGAGAGTTTGCATGCTTAGCAAAC
AAGGCCCCGGGCCCTATAGTCTCCCCATTTCCATCAAAAC
ACAACCCGCAGAGGAAGTTTTTGCTGTGAACTTCAAAGTG
AAAGCTGCAATGAAGAGTTCAGTTCTGCTGACCTGGGAGT
CTCGAACCACCAGTAATAAAGCGCAGTCTCTCATCATCTC
ATATGGCGATGGCGAGAGTGTGGAGGTCGATGGGCGGCTC
GGGCAGAAGTTAGTGACTAAGCTAAAGCCTCAGTCTCTGT
ACAACTTTCTGTTAACCAGTAAATCCGACAGCACTGGAGG
CCTGCAGCACCGCACGGACGCCATGACGGCTCCAAACCTG
ATGACCAGGAAACCACAGCTGCTGGACAAGACCAGCTCGC
AGAGCATTGCCATTCTGCAGCTGCCCACTGTACAAGGCCA
GGCTAACGTCAGGGGTTTCTACATTTTGGTCGTTCCTTTG
AAAAGGCAGAGAGCAGGAAACTTCCAGAATATGTGGAGCG
ATCCAGACGAGATGAACCTCGATGAGCTGCTGAGGGAGAT
TAATGGCACCGGTCGCTCTGTGCGTTTACGGAGGCAGGCA
GAGGCAAAGCCTTACATCACTGCTCATTTCCAAAATCTTC
CTGCTGAATTTAAGTTAGGAGATGGACATGTGTATGGAGC
CTTCATGAACCGACCTCTGGTGAACGGACAGGAGTATGTG
TGCTTCGTACTGGCTATTCTCGAACTGGGCCAGAATACTG
TCTACTCCACAAGCCCATTCTCTGATGCGGTGCTCTTCTC
TGATGTGGAGCCACAGCCAATCGTAGATGAGGAGGAGGGA
CTTCTGTGGGTGGTTGGACCAGTGTTGGCCGTCATCTTCA
TCATCAGCATCGTCATCCTCATCCTCCTCTTTAAAAGCAA
ACCAGACAGGAAGCGGGCAGAGTTGGAGGGCAGGAAGTGC
AGCTTTCCCAGCAGCGGTAAAGCCATGAGTTCCCAGCATC
CATCTGACCCCGTGGAGCTGCGCAGAATCAACTTCCCAAC
GGCTGGCATGACCAGCCACCCGCCAGTGTCCGTCTCTGAA
CTGCCCGCTCACATAGAGAGGATGAAGGCCAATGACAGCC
TGAGGTTCTCTCAAGAGTATGAGTCTATTGATCCAGGGCA
GCAGTTCTCCTGGGAACATTCTAACCTTGAGATTAACAAG
CCAAAGAACAGATATGCCAACGTCATCGCCTACGACCACA
CCAGAGTCGCCCTCACCAACACTGATGGTGTTGCTGGTGG
TGACTACATTAATGCCAACTTCATAGATGGCTACCGCAGA
CAGGGTGCTTACATCGCCACCCAGGGGCCCATGCCAGACA
CGTTTAGTGACTTCTGGAGAATGGTGTGGGAACAACACAC
AGCGAATGTCATTATGATCACCAAACTTGAAGAGAAATCG
AGGAATAAGTGTGATCAGTATTGGCCCAGCAGAGGAACGG
AAACATACGGACTGATGCAGGTCTCTCTACTGGACACGGT
GGAGCTTGCAACCTACTGCGTCAGGACGTTTGCCCTCTTT
AAGAGTGGGAGTGGTGAGAAGCGGGAGGTCCGTCAGTTCC
AGTTTACAGCATGGCCAGATCAGGGGGTACCTGAACACCC
TACTCCCTTCCTGGCCTTCCTCAGACGGGTCAAAGCCTGC
AACCCCCCAGACGCTGGACCCATTGTGGTCCACTGCAGTG
CCGGTGTGGGCCGGACAGGCTGCTTCATTGTGATTGATGC
CATGCTGGAACGAGTGAAGCAAGAGAAGACGTTAGATATT
TACGGTCACGTGACTCTAATGCGCTCTCAGCGAAACTACA
TGGTGCAGACAGAGGAGCAGTATGTCTTTATTTATGAGGC
GCTGCTGGAGGCCGTTTCCTGCGGCAACACTGAAGTTCCG
GCCCGGAACCTGTACGCCTACATCCAGAGACTGTCACAGA
CGGAGCCGCCGGAGCACATCAGCGGAATGGAGCAGGAGTT
TAAACGGTTAGCTAATGCCAAAGCGCATAACTCCAGATTC
GTCAGTGCCAGCCTTCCATGCAATAAGTTCAAGAACCGGT
TGGTGAACATCATGCCATATGAGAGCACACGTGTGTGTCT
GCAGCCAATCAGAGGAGTGGAGGGATCTGACTACGTCAAT
GGCAGTTTTATAGACGGCTACAGGCAACAGAGGGCGTATA
TTGCGACTCAGGGGCCACTGGCAGAGACAGTTGAAGATTT
CTGGAGAATGCTTTGGGAACACAATTCTACTATAGTAGTT
ATGCTTACTAAACTCAGAGAAATGGGAAGGGAGAAATGTC
ATCAGTACTGGCCGTCTGACCGATCAGCCCGATACCAGTA
CTTTGTTGTGGATCCCATGGCGGAATACAACATGCCTCAG
TATATACTCCGAGAGTTTAAAGTCACAGACGCCAGGGATG
GACAATCCAGAACAGTCCGGCAGTTTCAGTTCACGGATTG
GCCAGAGCAGGGTGTGCCAAAATCTGGCGAAGGGTTCATT
GACTTCATTGGTCAAGTGCACAAAACAAAAGAACAGTTCG
GTCAGGATGGGCCAATCACAGTACACTGCAGTGCTGGCGT
TGGAAGGACAGGTGTATTTATCACTCTCAGTATAGTGTTG
GAGAGGATGCGTTATGAGGGAGTAGTCGATATCTTCCAGA
CTGTCAAAATGTTGCGAACTCAAAGACCAGCCATGGTGCA
GACAGAGGAGCAGTACCAGTTCTGCTATCGAGCAGGGCTG
GAATACCTGGGCAGTTTTGATCACTATGCAACATAAAACC
TTCCCCTGGACCAAGAGCCACCTCATCATCATCACCACCA
CCACAACATCACAGCGAGACCTGCGTCTGATCAATCCGAC
AGCTTCTTTCTGCTGCTCAAGAGTCTGTTTGATTCCTCCA
GACAGCACACAGTTTAACAGTCAGCCAGAGAGGTCAGCTG
CGATACTGCGTTGTCACCACAAATTGCAGCTCCAGTCATA
GAACTGAAAGTTGTCAAGTCATATTGGGACTGGAGGAAAT
CGGTATGTGCTGTCTGGACCGATTCAATAGACCAGTGAGA
CTCCGAAAGCATTAGAAGAGACAACAATCAAACAGTTGAA
TGCTACTTTATACTTGTCCGAATTTATGAACCACCAAACC
CCTCGCAAAAAAAACAACAGTCATGTTTATAACAGGATGC
AGTCCGAGTGTAGAGTTGCCACTGTTTTTAGTCACCAGTT
TGTATAACGGATCCACCAACTCACTTGTTTAAGTGATTCG
TACAAAATGAAATTCAACAACACAGCCTAAGTATTGGTGC
TTACGCCAGTTTCCTGTTTGTTTATCTGTAGCGCGCACAC
ACACACAAGCGTAGATATATACGTACAAATCTATCACAGA
TTTAAGACGAGAAAAAAGTAAGTTAAAATGGAGATTTGTC
TCAAAAGCTGTGCAATATTGAACGTGATTATTGATCGCAC
CTTCGA

ptprdb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ptprdb-201 (1) 1140
ptprdb-202 6806
ptprdb-203 (1) 957
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptprdb-202 Contained in:

OTHER ptprdb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036312 (1)
  • Ensembl_Trans:ENSDART00000131579 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT721167 (1) 879 bp
    GenBank:EH457422 (1) 876 bp
    GenBank:DN896824 (1) 624 bp
    GenBank:AL923856 (1) 539 bp
    GenBank:CR930698 (1) 539 bp
    CITATIONS (2)