Transcript

cnot2-204

ID
ZDB-TSCRIPT-090929-19141
Name
cnot2-204
Previous Names
  • cnot2-004
  • zgc:162316-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038791 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038791|OTTDARG00000028472|ZDB-GENE-070410-70 cnot2|OTTDARP00000031069 DKEY-23P11.1-004 LG_none CR376836.6,CR382363.14 Danio rerio protein_coding KNOWN, 563 bp
GTGAAAACGTGACAGGAATAGATCTCTCAGAATTCCCAGC
ACTTGCAGACAGAAGTCGGAGGGAGGGAAATGGCAACCCT
ACACCGTTGCATAATCCACTGGCTGGAAGGGCGCCCTATG
ACAATATCCCTCAAAGGTTTGTTAAAATGTGTTTGTGTGC
AGTTGGAATGGTCACAAAGCCATCGAACGAACAGTCGCAG
GACTTTTCAATTCACAACGAAGACTTCCCAGCCCTGCCTG
GCCCCAACTATAAGGACCCGACATTAAGCACGGATGAAAG
CAAATCAAGCTTAAACTCTTCAGGCAAAGGCAGCTCGAGT
GCAGATGGACCCAAGTTTCCCGGTGACAAGACATCATCAG
CACAGAATAACAACCAGCAGAAGAAAGGGATCCAGGTGTT
GCCTGACGGCAAGGTAACGAACATTCCCTCAGGAATGGTG
ACAGATCAGTTTGGAATGATTGGACTCTTGACATTCATTA
GGGCAGCTGAGACAGATCCTGGGATGGTTCACCTAGCCTT
AGGAAGTGACCTAACAACGCTAGGACTCAACCTTAACTCT
CCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations