Transcript

cnot2-202

ID
ZDB-TSCRIPT-090929-19140
Name
cnot2-202
Previous Names
  • cnot2-003
  • zgc:162316-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038790 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038790|OTTDARG00000028472|ZDB-GENE-070410-70 cnot2|OTTDARP00000031068 DKEY-23P11.1-003 LG_none CR376836.6,CR382363.14 Danio rerio protein_coding KNOWN, 566 bp
TCCACTCATAGCATGATGCTGTTCGCGAAATTATAGCAAA
GTTTTATCGTGGACATCCTTAATGCAAGACTTTGTTTGAC
AAAAGACCCTGTACTTTTTTTCTTAATGCACTTTAAAGCG
GCTTATATAGCCTTGGGTCTTGTTCTGCAGTGGTAATTCA
TTATTTATTACTAGTTCTCAGTGTTGCTGTGTAGAAGAAC
TTGTTTTTGATGTTCAGCTGATGTGACAAACGGAATGTTC
GGTGCAACGAGAAAGAAGTTTGATGGGGTCGAAAGTGACT
ACCCTGATGAGAGCATGTACTATAACCAGGCATCTATGTT
CCAGCATCGATCGGAGAAAGACATGCTGCCGTCTCCCTCG
CCGTCATCGTCAGGTCAATTGTCACAGCTTGGTGCAAGTT
TGTACGGTCCTCAAAGTGCACTAGGATTCTCAATAAGGGG
CATGAGCAACAACAACCCTCAATTGAACCGGAGTTTAACA
CAAGGCACTCAGTTACCGAGCCATAGCACCCCAACGACAG
GCGTCCCAACAATGTCCCTCCACACAACACCACCTTCGCC
GAACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations