Transcript

cnot2-203

ID
ZDB-TSCRIPT-090929-19139
Name
cnot2-203
Previous Names
  • cnot2-002
  • zgc:162316-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038789 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038789|OTTDARG00000028472|ZDB-GENE-070410-70 cnot2|OTTDARP00000031067 DKEY-23P11.1-002 LG_none CR376836.6,CR382363.14 Danio rerio protein_coding KNOWN, 693 bp
CAACAGTATCCACTCATAGCATGATGCTGTTCGCGAAATT
ATAGCAAAGTTTTATCGTGGACATCCTTAATGCAAGACTT
TGTTTGACAAAAGACCCTGTACTTTTTTTCTTAATGCACT
TTAAAGCGGCTTATATAGCCTTGGGTCTTGTTCTGCAGTG
GTGACAAACGGAATGTTCGGTGCAACGAGAAAGAAGTTTG
ATGGGGTCGAAAGTGACTACCCTGATGAGAGCATGTACTA
TAACCAGGCATCTATGTTCCAGCATCGATCGGAGAAAGAC
ATGCTGCCGTCTCCCTCGCCGTCATCGTCAGGTCAATTGT
CACAGCTTGGTGCAAGTTTGTACGGTCCTCAAAGTGCACT
AGGATTCTCAATAAGGGGCATGAGCAACAACAACCCTCAA
TTGAACCGGAGTTTAACACAAGGCACTCAGTTACCGAGCC
ATAGCACCCCAACGACAGGCGTCCCAACAATGTCCCTCCA
CACAACACCACCTTCGCCGAACAGGGGGATCCTACCCATG
AACACCAGGAACATGATGAGCTCGCAGGTAGGGCAGGGCA
TGGGTATGAGCGGCAGGACCAACAGTATGGGCAGTTCTGG
CCTGGGCAGCCCAAACCGCAGCTCTCCCAGCATTATCTGC
ATGCCCAAGCAGCAGCCAGCACGCCAGCCATTCACCATCA
ACAGTATGTCAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations