header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18651
Transcript Name: eno1a-202
Previous Names: eno1-002, eno1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038261 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038261|OTTDARG00000028176|ZDB-GENE-030131-6048 eno1a|OTTDARP00000030663 eno1-002 LG_ CR388207.13 Danio rerio protein_coding KNOWN, 986 bp
CTGCCTTCTCTGCTCTGCACCACGGTCCACACTCGACTGC
CCTTGCGCTGGTTAGGCCAGATAAGAAACTGCAACATGTC
TATCCTGAAGATCCATGCTCGTGAAATCTTTGACTCCCGT
GGAAACCCCACTGTGGAGGTTGATCTGTACACCAAAAAAG
GTCTCTTCAGAGCTGCAGTGCCCAGTGGTGCCTCCACTGG
TATCTATGAAGCCCTTGAACTTCGTGACAATGACAAGACA
CGCTATCTGGGCAAAGGGGTGAAAAGAGCTGTTAAATATG
TAAATGAGTTCTTGGCCCCTGCTTTGTGTAATCAGAACGT
GTCAGTCTTGGAACAGGAGAAGATTGATAAGCTGATGCTC
GATATGGATGGCACAGACAACAAGTCAAAGTTTGGTGCTA
ATGCCATCCTGGGCGTTTCCCTGGCTGTGTGCAAGGCTGG
TGCTGCAGAGAAGGGCGTCCCCCTTTACCGCCACATCGCA
GACCTCGCTGGCAACCCTGAAGTCATTCTCCCAGTGCCTG
CCTTCAACGTTATCAACGGCGGCTCTCATGCCGGCAACAA
GCTGGCCATGCAGGAGTTCATGATCCTGCCCGTCGGTGCC
AGCAACTTTAAAGAGGCCATGCGCATCGGTGCTGAAGTCT
ATCACAACCTGAAGAATGTCATCAAGGAGAAGTACGGCAA
AGATGCCACCAATGTGGGCGATGAAGGCGGTTTCGCCCCC
AACATCCTTGAGAACAAAGAAGCTCTGGAGCTGCTGAAGA
ATGCCATCAGCAAAGCCGGCTACACCGACAAGATTGTGAT
CGGCATGGATGTGGCCGCCTCTGAGTTCTACAAGGGTGGC
AAATACGACCTGGACTTCAAATCACCTGATGACCCCAGCC
GTTACATCAGCCCTGACAAGCTGGCTGACCTCTACAAGAG
CTTTGTCAAGGATTATCCTGTGGTCTCCATCGAGGATCCA
TTTGACCAGGATGACTGGGAGGCCTG

eno1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA eno1a-003 (1) 738
eno1a-004 (1) 848
eno1a-005 (1) 738
mRNA eno1a-201 (1) 1996
eno1a-202 986
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eno1a-202 Contained in:

OTHER eno1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038261 (1)
  • Ensembl_Trans:ENSDART00000133322 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH583633 (1) 1020bp
    GenBank:EE713696 (1) 930bp
    GenBank:CK684023 (1) 774bp
    GenBank:CK678551 (1) 539bp
    CITATIONS (2)