header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18650
Transcript Name: eno1a-201
Previous Names: eno1-001, eno1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038260 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038260|OTTDARG00000028176|ZDB-GENE-030131-6048 eno1a|OTTDARP00000030662 eno1-001 LG_ CR388207.13 Danio rerio protein_coding KNOWN, 1996 bp
GCGGCGCTCGCTCTGACAGCTTCCTGATACCCTACACACT
TAACAGTGCACGAGTCCAACAGCCTCCTGCCTTCTCTGCT
CTGCACCACGGTCCACACTCGACTGCCCTTGCGCTGGTTA
GGCCAGATAAGAAACTGCAACATGTCTATCCTGAAGATCC
ATGCTCGTGAAATCTTTGACTCCCGTGGAAACCCCACTGT
GGAGGTTGATCTGTACACCAAAAAAGGTCTCTTCAGAGCT
GCAGTGCCCAGTGGTGCCTCCACTGGTATCTATGAAGCCC
TTGAACTTCGTGACAATGACAAGACACGCTATCTGGGCAA
AGGTGTCTCAAAAGCAGTTGAGCATATCAATAAAACAATT
GCACCTGGTCTGGTTAGCCAGAACGTGTCAGTCTTGGAAC
AGGAGAAGATTGATAAGCTGATGCTCGATATGGATGGCAC
AGACAACAAGTCAAAGTTTGGTGCTAATGCCATCCTGGGC
GTTTCCCTGGCTGTGTGCAAGGCTGGTGCTGCAGAGAAGG
GCGTCCCCCTTTACCGCCACATCGCAGACCTCGCTGGCAA
CCCTGAAGTCATTCTCCCAGTGCCTGCCTTCAACGTTATC
AACGGCGGCTCTCATGCCGGCAACAAGCTGGCCATGCAGG
AGTTCATGATCCTGCCCGTCGGTGCCAGCAACTTTAAAGA
GGCCATGCGCATCGGTGCTGAAGTCTATCACAACCTGAAG
AATGTCATCAAGGAGAAGTACGGCAAAGATGCCACCAATG
TGGGCGATGAAGGCGGTTTCGCCCCCAACATCCTTGAGAA
CAAAGAAGCTCTGGAGCTGCTGAAGAATGCCATCAGCAAA
GCCGGCTACACCGACAAGATTGTGATCGGCATGGATGTGG
CCGCCTCTGAGTTCTACAAGGGTGGCAAATACGACCTGGA
CTTCAAATCACCTGATGACCCCAGCCGTTACATCAGCCCT
GACAAGCTGGCTGACCTCTACAAGAGCTTTGTCAAGGATT
ATCCTGTGGTCTCCATCGAGGATCCATTTGACCAGGATGA
CTGGGAGGCCTGGACCAACTTCACCGCCACCACTAACATC
CAGGTGGTGGGTGATGACCTCACAGTGACCAACCCCAAGC
GCATCGCTAAAGCCGTGTCTGATAAGGCCTGCAACTGCCT
GCTGTTAAAGGTCAACCAGATCGGCTCGGTCACCGAGTCC
CTGCAGGCCTGTAAGATGGCCCAGACTAATGGATGGGGTG
TGATGGTCAGTCACCGTTCTGGAGAGACGGAGGACACCTT
CATCGCTGACCTTGTAGTCGGACTCTGCACTGGCCAGATT
AAGACTGGAGCTCCCTGCCGATCTGAGCGTCTGGCCAAGT
ACAATCAGCTGCTGAGGATTGAGGAGGAGCTAGGAGACAA
GGCTCGCTTCGCTGGCAAGAACTTCAGGAAACCCATCTGA
AGCACTGACCCGTCCTGAGTCTCGGCGTGTTCATCCTGCT
TTACTGTCCCACACATAAACGCCACGCAAAGCCACATCCT
GTAGAATGGAGATTAGATGGAAAAGCAGTGAAACGAAAGG
TCCAGATCAATAGCGTATGGCGCAGAACACTGCCAGATCT
CCATCTGTGCTTTGGTATCCAAATAGCATCAGTCCCTTAA
TCGTGTCTCTGTGTTGTGTGAGAGATCTTTGTTTAGTTTC
TTGTGATTTGTAGTGATTCTGGTGCTCCACTCAATATTTT
AGCAGAGATCAAGCCATTTAATGTGCTGCGACGTGCAGCG
TCAGTATGTGCGTTGTGTTGCTTTTGAGAAGTGTTAGTTC
TATATGCGTGGCATAACAAATAAATTATACCTATTGAAAT
GGACATGTATGTGTGGCTGAAGTTTATTTTTTGACTGTTA
TATTATACACGTTTGAAATAAACTTTATATTTAAGGTTAG
AATTTGAAATAAAAAATATTTGCATTTAAATATTCTGCTG
ATTGCCTAATACCCTGAATAAATAAAGAAACCAGAA

eno1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA eno1a-003 (1) 738
eno1a-004 (1) 848
eno1a-005 (1) 738
mRNA eno1a-201 1996
eno1a-202 (1) 986
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eno1a-201 Contained in:
OTHER eno1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038260 (1)
  • Ensembl_Trans:ENSDART00000009337 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC071359 (1) 1797bp
    GenBank:BC059511 (1) 1792bp
    GenBank:EH432943 (1) 1057bp
    GenBank:BM025963 (1) 510bp
    CITATIONS (2)