header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18652
Transcript Name: eno1a-003
Previous Name: eno1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038262 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038262|OTTDARG00000028176|ZDB-GENE-030131-6048 eno1a|no_translation eno1-003 LG_ CR388207.13 Danio rerio protein_coding KNOWN, 738 bp
GCCTTCTCTGCTCTGCACCACGGTCCACACTCGACTGCCC
TTGCGCTGGTTAGGCCAGATAAGAAACTGCAACATGTCTA
TCCTGAAGATCCATGCTCGTGAAATCTTTGACTCCCGTGG
AAACCCCACTGTGGAGGTTGATCTGTACACCAAAAAAGGT
CTCTTCAGAGCTGCAGTGCCCAGTGGTGCCTCCACTGGTA
TCTATGAAGCCCTTGAACTTCGTGACAATGACAAGACACG
CTATCTGGGCAAAGGTTTGTATATAAGATATTTGTAGATT
TAAAACATCGTTATCTAATTATAAGTCTTTTGATTCGTAG
CTTAAGTTCTAACTATATCTACTTTGTTTTATATGTGTGT
GTAACTTTATATTTTTGTATAAAGATGGTTGAAATGTTTT
TGAGCATTATGGCTTGTCAAAACTATTTATTAACTTGTTA
TAAAAATGGTAAATTGATAATGTCCAGAATCCTATTTCTT
CTTTAGAAGTTTTGTTTAGAAAATAATCTGGATTGAATGA
ATTAAATTATATTTAGCAGTACAAACTTCTTTTACTTTAA
ATAATTATAGTAATAATAGTAATAATAAAAATGCATGTTG
ACCATCAAATTATTTCAGATTTGTTATCATATTATTTCTT
AGATGATTTCTGAAAGATTGAAGTAATGACACTGAAGACT
GAAGTTATGACTTTGCTTTGACACGTATAGAAATGTTACA
TTTAAATTCATTTTATTT

eno1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA eno1a-003 738
eno1a-004 (1) 848
eno1a-005 (1) 738
mRNA eno1a-201 (1) 1996
eno1a-202 (1) 986
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eno1a-003 Contained in:
OTHER eno1a-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038262 (1)
  • Ensembl_Trans:ENSDART00000148136 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK682353 (1) 743bp
    CITATIONS (2)