Transcript

smc1al-003

ID
ZDB-TSCRIPT-090929-18536
Name
smc1al-003
Previous Names
  • smc1a-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038145 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038145|OTTDARG00000028117|ZDB-GENE-040426-57 smc1al|no_translation smc1a-003 LG_none CT025883.6,CR376802.12 Danio rerio protein_coding KNOWN, 746 bp
GTTGTGTTTATGGAACAGTTAGCCCGCGCTGCAGGATTCT
GCGTCCGCTTATTTTTGGTTTTGCTACGACTGATAACTTG
AGTGTATTATAATGGTTTAGTTTAAATTTTGTTCTGCTGT
GGAGCCCGGTTATTTTAGTGAAATATTTGTTAGTGTTTGT
CTAAATTTGACGTGTCTGAGTTATTACTTTGTTCTCATTG
TTCGTGCTAGCAATAGACACTCAGGCCGTATTCAGACAGT
TCACGTTTTATTATTTGTATAATCAAAGTCCTTGAAGTAA
GTGGTTCAGCATGGGCTACTTAAAGTTGATAGAAATCGAA
AACTTTAAGTCTTACAAAGGTAGACAGATAATCGGGCCTT
TCCACAAGTTTACTGCCATTATTGGGCCGAACGGATCGGG
AAAATCCAATCTCATGGATGCTATCAGCTTTGTTCTGGCA
GAGAAGACCAGCAATTTACGTGTAAAAACGCTAAAGGATT
TGATTCATGGAGCTCCTGTGGGAAAACCTGCTGCTAACCG
AGCATTTGTGACCATGGTGTACCAGCAGGATGGAGGACAG
GAGCTTTCATTTTCCAGAATCATCATAGGTACACATTCGC
ACATTTTTAAGAAGATTGTTGTGGTTAAAAAAAAAAAACG
AATGAAATGTCATTTTAAATTAATGCAATGAGGATTTCTG
TTTCTAAAAAAAGTTGACCATTCTGTATCTTTATTTCAAT
GTCATTTTCTTGTATTTCACCCCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations