ZFIN ID: ZDB-TSCRIPT-090929-18535
Transcript Name: smc1al-002
Previous Name: smc1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038144 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038144|OTTDARG00000028117|ZDB-GENE-040426-57 smc1al|OTTDARP00000030577 smc1a-002 LG_none CT025883.6,CR376802.12 Danio rerio protein_coding KNOWN, 1750 bp
CTTGAGTGTATTATAATGGTTTAGTTTAAATTTTGTTCTG
CTGTGGAGCCCGGTTATTTTAGTGAAATATTTGTTAGTGT
TTGTCTAAATTTGACGTGTCTGAGTTATTACTTTGTTCTC
ATTGTTCGTGCTAGCAATAGACACTCAGGCCGTATTCAGA
CAGTTCACGTTTTATTATTTGTATAATCAAAGTCCTTGAA
GTAAGTGGTTCAGCATGGGCTACTTAAAGTTGATAGAAAT
CGAAAACTTTAAGTCTTACAAAGGTAGACAGATAATCGGG
CCTTTCCACAAGTTTACTGCCATTATTGGGCCGAACGGAT
CGGGAAAATCCAATCTCATGGATGCTATCAGCTTTGTTCT
GGCAGAGAAGACCAGCAATTTACGTGTAAAAACGCTAAAG
GATTTGATTCATGGAGCTCCTGTGGGAAAACCTGCTGCTA
ACCGAGCATTTGTGACCATGGTGTACCAGCAGGATGGAGG
ACAGGAGCTTTCATTTTCCAGAATCATCATAGGTTCCTCT
TCAGAGTACCGCATCAATAATAAAGTGGTGGGTCTGTCTG
ACTACAGTGAGGAACTGGAGAAACTAGGAATCCTCATCAA
GGCCAGAAACTTCCTTGTCTTTCAGGGTGCTGTAGAGTCA
ATTGCAATGAAGAACCCCAAAGAGAGAACAGCTCTGTTTG
AAGAGATTTCTCGCTCTGGAGAGCTTGCCCAAGAATATGA
CAGATGCAAAAAAGAAATGGTCAAGGCTGAAGAGGACACG
CAGTTTAACTACCATCGCAAGAAAAACATAGCTGCTGAAC
GAAAAGAAGCCAAACAGGAAAAAGAGGAGGCAGAGCGTTA
TCAACGCCTGAAGGATGAGGTGGTGCGAGCTCATGTACAG
TTACAGCTGTTTAAACTGTACCACAATGAATCAGAGATTG
AGAAACTTAACAGAGAGCTGGCCCACCGCAATAAAGAGAT
TGATAAAGACAGAAAGCGCATGGACCGTGTGGAGGAAGAG
TTAAAAGACAAAAAGAAGGAGCTTGGCAGAATGATGAGAG
ACCAACAGATGATTGAGAAAGAGATCAAGTGAGTTTAAAC
CTTCTAAAAATCTCCCAATTAATCTTAAGAACAAAATAAC
AATTTTTAATTGTTTAATAAATTTTGTAGTGTTTGGCCTC
AATTCATTGTTGTATTTTACATATTAAAGGGGTTACAAAA
GGCAGTGCCTTACAACAGTGTGTGTAAGTAAAAAAACAAA
CAAACAAAAAAACATTGAGCATGTGGAAGAAAACAAAGTG
TATCAATTTGTGTAAAGTATGTTTAAACATCACTCTACTG
AACTGCTGACAACAAAATAAACAATTTAAATAGAGTTGTG
TTGCGTCAAACTGAGTGCTCATAAGAATTTTCACTTGATT
TAGTAGTTAATATTATAGCCTACATAACTAAATGATAAAG
TGTAATATTAAACGATAGCTTCATTTTGTCTATATAATAC
ATATTTTCATTTGCACAGCCATAATAAACAGCAATTAATG
CATTCATTTTGAAAATACTCTTATTTACCCTGACAATTTT
TAAGAACCATAACAAATATTAGCAAAAGTTAGTGTATAAA
TGTATAAATTTTGCATTTTGTACATATCATATTATGCACT
TTTTTTAAACTGAAATTTATTTTGTATGAAAAATGCATTA
ATTCTGATGTAACCAAAAAAGCACTTATAAGCACCCTGCA
GTAACTATATTACTATGTAGAGTAAAACTA

smc1al TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA smc1al-001 (1) 4396
smc1al-002 1750
ncRNA smc1al-003 (1) 746
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smc1al-002 Contained in:
OTHER smc1al-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038144 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC066674 (1) 1814bp
    CITATIONS (1)