Transcript

smc1al-201

ID
ZDB-TSCRIPT-090929-23107
Name
smc1al-201
Previous Names
  • smc1al-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000038143 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038143|OTTDARG00000028117|ZDB-GENE-040426-57 smc1al|OTTDARP00000030576 smc1a-001 LG_none CT025883.6,CR376802.12 Danio rerio protein_coding KNOWN, 4396 bp
ATTGAAATCTCGCGATGAGTGTTGTGTTTATGGAACAGTT
AGCCCGCGCTGCAGGATTCTGCGTCCGCTTATTTTTGGTT
TTGCTACGACTGATAACTTGAGTGTATTATAATGGTTTAG
TTTAAATTTTGTTCTGCTGTGGAGCCCGGTTATTTTAGTG
AAATATTTGTTAGTGTTTGTCTAAATTTGACGTGTCTGAG
TTATTACTTTGTTCTCATTGTTCGTGCTAGCAATAGACAC
TCAGGCCGTATTCAGACAGTTCACGTTTTATTATTTGTAT
AATCAAAGTCCTTGAAGTAAGTGGTTCAGCATGGGCTACT
TAAAGTTGATAGAAATCGAAAACTTTAAGTCTTACAAAGG
TAGACAGATAATCGGGCCTTTCCACAAGTTTACTGCCATT
ATTGGGCCGAACGGATCGGGAAAATCCAATCTCATGGATG
CTATCAGCTTTGTTCTGGCAGAGAAGACCAGCAATTTACG
TGTAAAAACGCTAAAGGATTTGATTCATGGAGCTCCTGTG
GGAAAACCTGCTGCTAACCGAGCATTTGTGACCATGGTGT
ACCAGCAGGATGGAGGACAGGAGCTTTCATTTTCCAGAAT
CATCATAGGTTCCTCTTCAGAGTACCGCATCAATAATAAA
GTGGTGGGTCTGTCTGACTACAGTGAGGAACTGGAGAAAC
TAGGAATCCTCATCAAGGCCAGAAACTTCCTTGTCTTTCA
GGGTGCTGTAGAGTCAATTGCAATGAAGAACCCCAAAGAG
AGAACAGCTCTGTTTGAAGAGATTTCTCGCTCTGGAGAGC
TTGCCCAAGAATATGACAGATGCAAAAAAGAAATGGTCAA
GGCTGAAGAGGACACGCAGTTTAACTACCATCGCAAGAAA
AACATAGCTGCTGAACGAAAAGAAGCCAAACAGGAAAAAG
AGGAGGCAGAGCGTTATCAACGCCTGAAGGATGAGGTGGT
GCGAGCTCATGTACAGTTACAGCTGTTTAAACTGTACCAC
AATGAATCAGAGATTGAGAAACTTAACAGAGAGCTGGCCC
ACCGCAATAAAGAGATTGATAAAGACAGAAAGCGCATGGA
CCGTGTGGAGGAAGAGTTAAAAGACAAAAAGAAGGAGCTT
GGCAGAATGATGAGAGACCAACAGATGATTGAGAAAGAGA
TCAAGGAGAAGGATGCAGAACTCAATCAGAAGAGGCCTCT
GTACATTAAAGCCAAGGAAAACACTGCCCACAAGATCAAG
AAATTGGAAGCTGCCCGTAAATCACTTCAGAATGCACAGA
AATGCTACAAAAAGCGCAAGGGAGACATGGATGAGCTGGA
TCGTGAGCAGGGGGCAGTTGAAATGGCCAGACAGGAGTTT
GAGGAGCGGATGGAGGAGGAGGCTCAAAGTCAGGGACAAG
ATCTACAGCTGGAAGAGAACCAGGTTAAGGCATATCACCG
TTTGAAGGAGGAGGCGAGTAAGCGAGCAGCTACCCTGGCT
CAAGAGCTAGAGAAATTCAACAGAGACCAGAAAGCTGACC
AGGACCGTCTGGACCTGGAGGAGAGGAAGAAAATAGAAAC
AGAGGCCAAGATCAAGCAAAAAATCAGAGAGATTGAGGAG
AACCAAAAACGCATTGAGAAGCTAGAGGACTATATCACTA
CTAGCAGGCAGTCTTTGGATGAACAGAAAAGAATGGAAGA
GGAACTCACAGAAGAAGTAGAACAGGCCAAACGAAGAATA
GATGAGATCAACATGGAACTTAACCAGGTGATGGAGCAGC
TGGGTGATGCTCGTATCGACAGGCAGGAGAATAGCAGACA
ACAGCGTAAAGCTGAGATCTTGGAGAGCATCAAGAGGCTG
TATCCTGGATCAGTGTACGGGAGACTGATTGACTTGTGCC
AGCCTACACAAAAGAAATATCAGATTGCTGTCACTAAAGT
GCTGGGCAAAAATATGGATGCCATTATTGTGGATTCTGAA
AAGACGGGTCGTGACTGTATCCAATACATAAAAGAGCAGC
GTGGTGAACCTGAGACCTTCCTCCCCCTGGACTATCTGGA
GGTCAAGCCCACAGATGAGAAGCTACGTGAGCTGCGTGGT
GCTAAATTGGTGATTGATGTAATTCGATATGAGCCACCAC
AGATTAAGAAAGCCCTGCAATATGCTTGTGGAAATGCCCT
GGTCTGTGATAATGTGGAGGATGCTCGCAGGATTGCCTTT
GGAGGACCATACAGACACAAGACTGTGGCTCTAGATGGGA
CGTTATTCCAGAAGTCTGGAGTGATCTCTGGTGGTGCCAG
TGATCTAAAGGCCAAAGCTCGACGTTGGGATGAAAAAGCT
GTTGATAAGCTGAAAGACAGAAAGGAAAAACTCACAGATG
AACTTAAAGAACAAATGAAGGCCAAAAGAAAGGAAGCAGA
GCTGCGTCAGGTTCAGTCTCAAGCTCATGGTTTGCAGATG
AGGCTCAAGTACTCCCAGAGTGATCTGGAGCAAACCAAGA
CCAGACACCTGTCCCTTAACATGCAGGAAAAATCAAAGCT
GGAAAGTGAACTTGCTAACTTTGGTCCACGGATTAATGAT
ATAAAGAGAATCATCCAGTCACGTGAGAGAGATATGAAAG
ACTTGAAGGACCGCATGAATGTGGTGGAGGATGAGGTGTT
TGTTGAGTTCTGTAAAGAGATTGGAGTTCGTAACATTCGT
GAATTTGAAGAAGAAAAAGTCAAAAGGCAGAACGAGATTG
CAAAGAAACGCTTAGAATTTGAGACTCAAAAAACACGTCT
GGCAATACAGCTGGATTATGAGAAAAACCAGCTGAAGGAA
GACCAAGAGAAGGTGGTCATGTGGGAACAGACGGTCAAGA
AAGATGAAAATGAGATTGAAAAGCTTAAGAAGGAAGAGCA
GAGGAATATGAAGATAATTGATGAGACCATGGCACAATTG
CAGGATCTGAAAAACCAGCACTTGACTAAGAAATCTGAGG
TTAATGATAAAAACCATGAAATGGAGGAGATCCGCAAGAA
ACTAGGGGGTGCCAACAAGGAGTTGACGCAGCTGCAGAAG
GAAGTGACTGCTATCGAGACCAAGCTGGAGCAAAAACGCA
GTGACAGACACAATCTACTGCAGGCTTGTAAGATGCAGGA
CATCAAACTTCCTCTCCGATCGGGAACTATGGATGACATC
AGCCAGGAAGAGGGCAATTCACAGGCAGAGGAGAGCCTCA
GCAGCAGTCAAAAGACATCGAGCACTGTCTTGGCCAAGGA
AGCTCTTATTGAGATTGACTACAACAGCTTGTCTGAGGAC
TTAAAAGACTCCTTGTCAGATGAGGAGATCAAGGCAGAGA
TGAACACATTACAGCAAAGACTCAATGAGCAGCAGAGCAT
CCTGCAAAGGATCAGTGCACCCAACATGAAGGCCATGGAG
AAACTAGAGAGTGTCAGAGACAAATTCCAGGAGACCAGCG
ATGAGTTTGAAGCTGCTAGGAAGAGGGCAAAGAAAGCCAA
GCAGGCATTTGAACAGATAAAGAAGGAGAGATTTGACCGT
TTCCACGCCTGCTTTGAGTCTGTGGCCACCAACATTGATG
AGATTTATAAAGCTCTGTCACGCAACAGCAGTGCCCAGGC
ATTTCTGGGACCTGAGAACCCAGAGGAGCCATACCTGGAT
GGTATAAACTATAATTGTGTGGCCCCAGGTAAACGTTTCA
GGCCCATGGACAACCTGTCTGGAGGAGAAAAGACTGTGGC
AGCTCTAGCCCTACTGTTTGCTATTCACAGCTATAAGCCT
GCTCCCTTTTTTGTTCTGGATGAGATTGATGCAGCACTGG
ATAATACCAACATTGGCAAGGTTGCAAACTACATCAAGGA
TCAGTCGGTGCAGAACTTTCAGGCTATTGTAATTTCCTTG
AAAGAGGAGTTTTACACTAAGGCTGACTCCCTGATTGGAG
TTTACCCAGAGCAAGGAGACTGTGTCATCAGTAAAGTTCT
GACCTTTGATCTCTCCCAGTATGCAGATGCCAATCCCAAT
CCAAATGAATGACATGTTTCTGGAAACAACTGTGTTTTGC
TCTGTTCTTTCTAAATATCAGCTTGTTTTAGTTCCAAGTT
TTCTCTTTAAACTCTTTCTCTGTTCTTCTTTCATTTAGAC
ACGTGATTAGACATTACCTGTGTGTTTTTGGTTTGTGATT
TTTGGCAATCATGTGATTTTGATTTAATCCAGACTAATTT
GAATTGAACATTTATTTTGATGCCATTACTTTTAAAGTTT
TATAGTGTACAACGTTACAATAGAGGCTAAGTAAATGAAG
ACTTGCAGCAATAATTTCTGTTCATTTGTAAAAGAATTAT
GTCTTTTGCAGTTACTGCTTTTTAAGTGTGACATTTTAAC
TAGTTTTCTCTTGAAAAATAAACAACTTTACAGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations