ZFIN ID: ZDB-TSCRIPT-090929-16513
Transcript Name: gstm.3-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035959 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035959|OTTDARG00000026762|ZDB-GENE-050309-24 gstm.3|OTTDARP00000028844 gstm3-002 LG_ CR847543.13 Danio rerio protein_coding KNOWN, 1001 bp
CGCCCATTCATCTCCGCTCACTGCTCCTGCACGAAGTTGG
CTGCAACATGGCAATGAAGCTGGCATACTGGGATATCCGC
GGGATTGCTCAACCAGTCCGTCTACTGTTGGAATTCACTG
GTACTAAATATGAGGAAAAGTTCTACTCCTGTGGTGAAGC
TCCTGACTATGACAAAAGCTGCTGGTTTAATGAGAAAAAC
AAACTTGGGCTGGCCTTTCCTAATTTGCCCTACCTAGAGG
ATGGTGATACAAAAGTAGTCCAGAGCAATGCCATACTAAG
ATACATTGCCCGCAAAAACAACCTCTGTGGGGAAACTGAA
GAAGAACAGACCAGAGTTGACATCTTGGAGAATCAGGCGA
TGGACTTCCGCAATGGTTTCATCCAGCTCTGCTATGGAGA
CTTTGACAAAAACAAACCATGTTACTGTGAGAAGCTGCCA
GGATCTCTAAAGCAGTTCTCTGACTTCCTTGGTGACAGGA
AGTGGTTCGCTGGGGACAAGATCACATTTGTGGATTTCAT
CATGTACGACTTGCTGGATTTACACCGTATGTTACATCCA
GAGTGTTTGGATGACTACAGAAACCTTCGATCTTTCCTGG
ATCACTTTGAGAGTCTCGAGAAGATTGTAGCATACATGAA
GTCAAACAAGTACATGAAAACTCCTGTGAACAACAAGATG
GCCAAATGGGGAAACAAGAAGGAGTGAAACTAACAAGATT
GCTGTCTGTTATTTTTGGTTCTACTTTTTTTTTTTTTTTG
AAACCTCCCAATGAACAAGAGTTTGTTCTTTTTTTCAGAT
GTACAAGCTACTGACACAGTGTTTGTCTACAAGTACAGTG
CAGCTGATTAGCACGTAAATTGATGTTGATGATGACAGTT
TGATGTCATTTCAGTGTTACATTATCGGTTTTCTACAAAC
AAATGTTTAAATGTAGGATCTTTTTTTACACAATAAAGTG
GTTCAGTGCATAAAAAGCCTCATTGAACAGAAATTAAAGC
C

gstm.3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gstm.3-001 (1) 1603
gstm.3-002 1001
ncRNA gstm.3-003 (1) 1125
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gstm.3-002 Contained in:
OTHER gstm.3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035959 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH452884 (1) 1027bp
    GenBank:EH472334 (1) 779bp
    CITATIONS (1)