ZFIN ID: ZDB-TSCRIPT-090929-16258
Transcript Name: gstm.3-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035663 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035663|OTTDARG00000026762|ZDB-GENE-050309-24 gstm.3|OTTDARP00000028641 gstm3-001 LG_ CR847543.13 Danio rerio protein_coding KNOWN, 1603 bp
CGCCCATTCATCTCCGCTCACTGCTCCTGCACGAAGTTGG
CTGCAACATGGCAATGAAGCTGGCATACTGGGATATCCGC
GGGATTGCTCAACCAGTCCGTCTACTGTTGGAATTCACTG
GTACTAAATATGAGGAAAAGTTCTACTCCTGTGGTGAAGC
TCCTGACTATGACAAAAGCTGCTGGTTTAATGAGAAAAAC
AAACTTGGGCTGGCCTTTCCTAATTTGCCCTACCTAGAGG
ATGGTGATACAAAAGTAGTCCAGAGCAATGCCATACTAAG
ATACATTGCCCGCAAAAACAACCTCTGTGGGGAAACTGAA
GAAGAACAGACCAGAGTTGACATCTTGGAGAATCAGGCGA
TGGACTTCCGCAATGGTTTCATCCAGCTCTGCTATGGAGA
CTTTGTGAGTGACTGATCATGTGACTATGCATTAGGGCTA
CATGATATTAGGAATATATGTGATATGGTTGTTGAGTATT
TTTATGATATTACTACCTTTAAAAAAAAGGCAATTTTATC
AGCAATTTATATAAAATATAGTGTAAAGATTATATTTAAA
CAGTTAAGTGATTTTTTTCAAAGCTAATAAAAATATCAAC
ATGGAAAAATTCTGATTTTTATTGGCTGATGTCATTTTCC
TCTTTATTCAACAAGCATTAGTAATTCTTTTCAGCTGTAG
GTTCACCTGACAGAACCTACTGGGTGAGATGGGAATGAAG
ATAGTAAAGGCCCCATCTGATTGGTCAGATTTGGATAAAC
AACCCATGCATGCAGCACACAAATGCTTCACGCATAAAAT
AATTCAGTTTATTGCGCTTCTCTGTGATATGAATATTACA
CGTTCCAGTGACTAGATTTACATGGACAGTAATCAATTTT
TTTGCCTTAATTTGAATAAGACAGTAGCCCCTTTCACACA
GTGATACTAGTAAATATCTGGAAAATTTTCGGAACGACTT
AAACTAAAGATTCAAAAAAGAATTACAGAATTTTTCCAGA
AAAGAGCATTCACACATCCATTCCAAAATACAGGTCAATC
CTGACATCATTAACCAGAAATGACCTCTAAGCGCGTGCAC
TTGTATACATTACAAACTCTGTGGATGGACATTGTGAGTA
TTGTAATCAACTTTGATGAAAACCTATAGAGGTACATTTT
CGCATGTCGAGATGTACATATTATGTGTGTGTGCTGGCAC
TCGCTGAAGGAAGCAGAGCTTGAAGGTAAACAAACAGCTG
TTTGTCGTAAGCATTTTATTGATAATTATTTATACAGTTG
GCATTAAGAATGAACATAGAAAAGTTTTCTGACTATCATC
TAGCAGCTAATCGTGTCTGGAAAAATATTCCAAGGCTTTT
ATTTTCATAAACAGCGTGGATGTGAATGTGTCTGAATGTT
CTGATTGGCTGGAGTAGACATCTCACGTCAGCGTGTTCTA
AGCATGAACGGGATCTTTCAGGCAATCTTCTTAATACGTT
CACACATCATATTTGGAACTCGCCATACAAAATATTGTAA
AAAACGATGTTACATATAGTTTCTAGGTATAATTTATACT
TCTAGATGTTTATTGGGGGCCCCCAGATTTTCTGGGCCCC
TAA

gstm.3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gstm.3-001 1603
gstm.3-002 (1) 1001
ncRNA gstm.3-003 (1) 1125
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gstm.3-001 Contained in:
OTHER gstm.3-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035663 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC115311 (1) 1554bp
    GenBank:CN505232 (1) 886bp
    GenBank:CK027614 (1) 758bp
    GenBank:DR725343 (1) 741bp
    CITATIONS (1)