header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16265
Transcript Name: gstm.3-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035670 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035670|OTTDARG00000026762|ZDB-GENE-050309-24 gstm.3|no_translation gstm3-003 LG_ CR847543.13 Danio rerio protein_coding KNOWN, 1125 bp
CAAACAAGATACTGGATGTGAGTATGAACTGCTGGAAGAG
TGTTGTTTTAATGGAATTTGATCCCACTCGCCAGCATGGG
GGAAAAAACTCCATATTTCATGATGCAGGTGTCTGTGGTC
CTTTACTGACTCGGTAGCTGCAGAGAATAGTTAAACAGCT
GTGTGTGTATAGACTATCCTGTCTCAAATGCTGCAAAAAT
CCTACACAATGATGATAGTTTGATTGCGATGTTTACGTGT
CTGTACTGCACTTTATTAATGCAACTAAAATCGGCATACT
CCATATGTCTTAGTCCGATTTCTGTTTTGTCCAAAAATGA
CCTTAATTAAATTAAATTAATAAAAAATGGCAGTTTAGAT
GGTAGACTCCTAATCAGAGTATTGTCTTAATCGTATTAAA
TTGGATTATTAGTGTTCATGTAAACACTCAGTTCAATGAT
AATTCAATGATAAATTTGTGCAGCCCTAATATGTATTAGT
GTTGAAGAAATGTTCAGATGATGTAGACTGTTTTTGATTA
CAGGACAAAAACAAACCATGTTACTGTGAGAAGCTGCCAG
GATCTCTAAAGCAGTTCTCTGACTTCCTTGGTGACAGGAA
GTGGTTCGCTGGGGACAAGATCACATTTGTGGATTTCATC
ATGTACGACTTGCTGGATTTACACCGTATGTTACATCCAG
AGTGTTTGGATGACTACAGAAACCTTCGATCTTTCCTGGA
TCACTTTGAGAGTCTCGAGAAGATTGTAGCATACATGAAG
TCAAACAAGTACATGAAAACTCCTGTGAACAACAAGATGG
CCAAATGGGGAAACAAGAAGGAGTGAAACTAACAAGATTG
CTGTCTGTTATTTTTGGTTCTACTTTTTTTTTTTTTTTGA
AACCTCCCAATGAACAAGAGTTTGTTCTTTTTTTCAGATG
TACAAGCTACTGACACAGTGTTTGTCTACAAGTACAGTGC
AGCTGATTAGCACGTAAATTGATGTTGATGATGACAGTTT
GATGTCATTTCAGTGTTACATTATCGGTTTTCTACAAACA
AATGTTTAAATGTAGGATCTTTTTTTACACAATAAAGTGG
TTCAGTGCATAAAAAGCCTCATTGAACAGAAATTAAAGCC
AAAAA

gstm.3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gstm.3-003 1125
mRNA gstm.3-201 (1) 1603
gstm.3-203 (1) 1001
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gstm.3-003 Contained in:

OTHER gstm.3-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035670 (1)
  • Ensembl_Trans:ENSDART00000141687 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK028018 (1) 1126bp
    CITATIONS (2)