header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16091
Transcript Name: bcar3-204
Previous Name: bcar3-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035471 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035471|OTTDARG00000026650|ZDB-GENE-080513-4 bcar3|OTTDARP00000028508 bcar3-003 LG_none CR381644.8,BX005425.12 Danio rerio protein_coding KNOWN, 537 bp
AATGAGTGTTTGACATCTGAATGTCTACTTTCCGAGGCAG
TTGGACTTAAATTGGACTGAAGAACAACACTGAAGTAGCA
ACAAAACGCTTGCGCGACCTCCAAGGACTTGCTGCACCTC
ACAGAGATGGATCTGTTGGGTTTGGGGGTCCAAAGTCGTC
TTCATCGAATCCATATTCTCTCTAGTATCCAAGTCCTGCG
AGAACGTGAAACAAAACGAGAGCTGAGGATGATGGCGGAA
GGGAGGTTTTCCAGTTTGCCCAGAAATATGCACGTTGGAC
GTCAGTGTCCGCTTGCATCCTCCATGGATCTGCTGAGCTC
ACGGCCGGAGCTCTCCGAGATGCCAGTCAGTGGATACCAA
GGCATCTCCATCCACGGCACACTGCCTCGCAAGAAGAAGA
CCACCACTGGTTCCCCTGTAAAGCAATGGGAGGTGAATGG
AAATGTAGGATCTTTAGCAGCGCCATACCCAGGCCGACAT
CGCCTGCCACCGTCACCGCTGATACACAACATCATCGAAG
AACACCAGACTTTCTGC

bcar3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bcar3-202 (1)    Ensembl 655
bcar3-203 (1)    Ensembl 2693
bcar3-204 537
bcar3-205 (1)    Ensembl 2390
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bcar3-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000035471 (1),  Ensembl_Trans:ENSDART00000141763 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CR929610 (1) 539 bp
CITATIONS (2)