Transcript

bcar3-204

ID
ZDB-TSCRIPT-090929-16091
Name
bcar3-204
Previous Names
  • bcar3-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035471 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035471|OTTDARG00000026650|ZDB-GENE-080513-4 bcar3|OTTDARP00000028508 bcar3-003 LG_none CR381644.8,BX005425.12 Danio rerio protein_coding KNOWN, 537 bp
AATGAGTGTTTGACATCTGAATGTCTACTTTCCGAGGCAG
TTGGACTTAAATTGGACTGAAGAACAACACTGAAGTAGCA
ACAAAACGCTTGCGCGACCTCCAAGGACTTGCTGCACCTC
ACAGAGATGGATCTGTTGGGTTTGGGGGTCCAAAGTCGTC
TTCATCGAATCCATATTCTCTCTAGTATCCAAGTCCTGCG
AGAACGTGAAACAAAACGAGAGCTGAGGATGATGGCGGAA
GGGAGGTTTTCCAGTTTGCCCAGAAATATGCACGTTGGAC
GTCAGTGTCCGCTTGCATCCTCCATGGATCTGCTGAGCTC
ACGGCCGGAGCTCTCCGAGATGCCAGTCAGTGGATACCAA
GGCATCTCCATCCACGGCACACTGCCTCGCAAGAAGAAGA
CCACCACTGGTTCCCCTGTAAAGCAATGGGAGGTGAATGG
AAATGTAGGATCTTTAGCAGCGCCATACCCAGGCCGACAT
CGCCTGCCACCGTCACCGCTGATACACAACATCATCGAAG
AACACCAGACTTTCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations