Transcript

bcar3-203

ID
ZDB-TSCRIPT-090929-16090
Name
bcar3-203
Previous Names
  • bcar3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035470 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035470|OTTDARG00000026650|ZDB-GENE-080513-4 bcar3|OTTDARP00000028507 bcar3-001 LG_none CR381644.8,BX005425.12 Danio rerio protein_coding KNOWN, 2693 bp
GCAAAACAGGATTGTCGTTCATGTTCGTCTTGTTGTTGTC
CTTCAGTGTGAATCTAGATCGCTATGCTTGCTGTGAAACT
GTAAAACTCGTACTCACAGATTGCAGGAGGAGGATATTTT
GGTTTTCGCTCACTTGGAAAAACTACAACCTTTAGCCAGA
GCTGAGGATGATGGCGGAAGGGAGGTTTTCCAGTTTGCCC
AGAAATATGCACGTTGGACGTCAGTGTCCGCTTGCATCCT
CCATGGATCTGCTGAGCTCACGGCCGGAGCTCTCCGAGAT
GCCAGTCAGTGGATACCAAGGCATCTCCATCCACGGCACA
CTGCCTCGCAAGAAGAAGACCACCACTGGTTCCCCTGTAA
AGCAATGGGAGGTGAATGGAAATGTAGGATCTTTAGCAGC
GCCATACCCAGGCCGACATCGCCTGCCACCGTCACCGCTG
ATACACAACATCATCGAAGAACACCAGACTTTCTGCTCAG
ACCGGAAACAATCAAGGAACAGCGCAGGAATGGACCCTAC
GATGGAGTACGTCAAGTTCTCAAGAGACAAGTACATCTTG
GATGGACCGCCGGAGAAACTTCGGAGGGAGTTGGAGGAAG
AACTGAAACTAAGCAGTGAGGAACCGAGGAGCCATGCCTG
GTATCACGGAGCCATTCCTAGACAGGTGGCTGAAAACCTG
GTCCAGCGAGATGGAGATTTTCTGATCCGGGACTCTCTGT
CCAGCCCTGGCAACTACGTTCTGACCTGTCAGTGGAAGAA
CAGCCCTCAACACTTCAAAATCAACAAGCGGGTCGTAGCC
ATGAACGAGGCCTACTCACGGGTTCAGTACCTGTTTGAGA
AGGAGGGATTCGATAGCATCCCCGCACTGGTGCGATATTA
CGTGGGCAACCGTGAGCCGGTCTCTGAGGTCATCGGAGCG
ATTATCTTCCAGCCGATCAACAGAGCTCTGCCTCTGAGGT
GCCTGGAGGAGAAATATGGAGTGGGATCTATACGTGTAGA
GGCAGGATATCTGGAGAGAAAGAGCCTGACGTCCAAACGG
CTGAGTCTGAATATCATGAATGGACACGGTCAGGATCACA
CCCTCAGCCGTGGAAACCTCCTCAGCAACAAGGATAAATG
TGGAAGTCAACCAGCATGTCTAAACCACGTTCAGGAGAGG
AGACGGCCGCTGAAGACCCATCAGTCGGAGAGCTTCCTCC
CTATCGGCTCCAGGCCGCAGGCTCAGGTTCAGCATATGGA
GCACCAGCCGTGCCCCAAATCTCCGGTTTTTCGAACGGGA
AGCGAGCCAGCACTGAGTCCCACAGTGCCACGCAGAATGG
CCTTTGACACTCTGCCTGGTGAGGCCATCCGCGGCTCTGA
CAGCCAGCTGTGTCCCAAACCACCCCCTAAACCCAGCAAG
GTCCCCACAGTAAGAGTACCGTGCATCCCAGCCCTGAAAA
CCCTTGTCGTCCCACCTGTCCCTCCAGTCAAGCCCCACAA
GCACAGACCTTCACTCCAGCAGCAGCAGTCAGGCAGTCCA
GAAATGAGCTACTGTGAACTGAGTCCATGCAGCCCTGCTG
ACTGGGAAAAGATGAACAGCTTACAGGCTAATGGATATGT
GGAGAGGCTAAAGACAGACGGCAGCATTAAACTAGACCGC
AGCTCCTACCACAACGCCATTGAGGCCTTAGACAACGACA
GCGAGGAAGACACCGAAGAGGATGCGGATAAAGAACAGAA
CGGCAAGAAAGCTTTCCAAAAACCTGTGTTTGAAACTGAA
TCAGCGTTCAGACCTGCAAATGTCAACTTCAGGCTGCTGC
CTAAGGAGAACAAGCCTCTGGAGATGACGGTGCTGAAGAA
AGCCAAAGAACTGCTGGTCAGTCAGGATCCAAAGACCATC
GCCAAACACATCCTGCAAGCAGACTGTCAGGTTGCCAGGA
TACTGAATGTTTCTGAGGAGGTGAAAGGTCAGATGGGTGT
GAGCTCCGGGCTGGAGCTGGTGACCCTTCCTCATGGACGA
CAGCTGAGGCTGGACCTCATAGAGAGGCATAACACTATGG
CGATCGGAGTGGCTGTGGACATCCTGGGGTGTACAGGAAG
TCTGGAGGAGCGAGCAGCCACACTAAACCGGATCATTCTG
GTGGCTCTGGAGCTCAAAGACTCCATGGGGGATCTTTATG
CCTTTTCCTCCATAATGAAAGCACTGGACATGCCTCAGAT
TACCAGACTGGATCACACATGGACTAGCTTGCGGAGGAAA
TATACACAGACTGCCATCATTTATGAGAAATCTTTAAAAC
CGTTCTACAAAGGACTCTATGAAGGAGGTGCTGAAATCCC
GCTGAGCAATGCCAGTGTTCCTCTGCTGATGCCGCTGCTC
ACCTTGATGGAGAGGCCTGCAGTCACCTTCGAGGGTATGG
ACGTCTGGGAGAACACCGATCAAGGCTGTGAAATCATGTT
TCGGCACCTGGAAGGAGCTCGAGCGGTTGCACGCAATGCA
GACACCTACACCTGCAATGCACAGCGGATCCTCCAGGACT
TCCAACCCCATGAAGACATGCTGGAGATCTTGAGGACAGA
TTTCCAGCTGCGTTTGCTCTGGGGGAGCAGAGGAGCTGCA
GTGGAGCAGACTGAGAGATACGACAAATTCAAGCTCATCC
TCACGGCCCTGTCTAGAAAACTAGAGCCTGCAGTCAAACA
CACAGAACTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations