header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16090
Transcript Name: bcar3-203
Previous Name: bcar3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035470 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035470|OTTDARG00000026650|ZDB-GENE-080513-4 bcar3|OTTDARP00000028507 bcar3-001 LG_none CR381644.8,BX005425.12 Danio rerio protein_coding KNOWN, 2693 bp
GCAAAACAGGATTGTCGTTCATGTTCGTCTTGTTGTTGTC
CTTCAGTGTGAATCTAGATCGCTATGCTTGCTGTGAAACT
GTAAAACTCGTACTCACAGATTGCAGGAGGAGGATATTTT
GGTTTTCGCTCACTTGGAAAAACTACAACCTTTAGCCAGA
GCTGAGGATGATGGCGGAAGGGAGGTTTTCCAGTTTGCCC
AGAAATATGCACGTTGGACGTCAGTGTCCGCTTGCATCCT
CCATGGATCTGCTGAGCTCACGGCCGGAGCTCTCCGAGAT
GCCAGTCAGTGGATACCAAGGCATCTCCATCCACGGCACA
CTGCCTCGCAAGAAGAAGACCACCACTGGTTCCCCTGTAA
AGCAATGGGAGGTGAATGGAAATGTAGGATCTTTAGCAGC
GCCATACCCAGGCCGACATCGCCTGCCACCGTCACCGCTG
ATACACAACATCATCGAAGAACACCAGACTTTCTGCTCAG
ACCGGAAACAATCAAGGAACAGCGCAGGAATGGACCCTAC
GATGGAGTACGTCAAGTTCTCAAGAGACAAGTACATCTTG
GATGGACCGCCGGAGAAACTTCGGAGGGAGTTGGAGGAAG
AACTGAAACTAAGCAGTGAGGAACCGAGGAGCCATGCCTG
GTATCACGGAGCCATTCCTAGACAGGTGGCTGAAAACCTG
GTCCAGCGAGATGGAGATTTTCTGATCCGGGACTCTCTGT
CCAGCCCTGGCAACTACGTTCTGACCTGTCAGTGGAAGAA
CAGCCCTCAACACTTCAAAATCAACAAGCGGGTCGTAGCC
ATGAACGAGGCCTACTCACGGGTTCAGTACCTGTTTGAGA
AGGAGGGATTCGATAGCATCCCCGCACTGGTGCGATATTA
CGTGGGCAACCGTGAGCCGGTCTCTGAGGTCATCGGAGCG
ATTATCTTCCAGCCGATCAACAGAGCTCTGCCTCTGAGGT
GCCTGGAGGAGAAATATGGAGTGGGATCTATACGTGTAGA
GGCAGGATATCTGGAGAGAAAGAGCCTGACGTCCAAACGG
CTGAGTCTGAATATCATGAATGGACACGGTCAGGATCACA
CCCTCAGCCGTGGAAACCTCCTCAGCAACAAGGATAAATG
TGGAAGTCAACCAGCATGTCTAAACCACGTTCAGGAGAGG
AGACGGCCGCTGAAGACCCATCAGTCGGAGAGCTTCCTCC
CTATCGGCTCCAGGCCGCAGGCTCAGGTTCAGCATATGGA
GCACCAGCCGTGCCCCAAATCTCCGGTTTTTCGAACGGGA
AGCGAGCCAGCACTGAGTCCCACAGTGCCACGCAGAATGG
CCTTTGACACTCTGCCTGGTGAGGCCATCCGCGGCTCTGA
CAGCCAGCTGTGTCCCAAACCACCCCCTAAACCCAGCAAG
GTCCCCACAGTAAGAGTACCGTGCATCCCAGCCCTGAAAA
CCCTTGTCGTCCCACCTGTCCCTCCAGTCAAGCCCCACAA
GCACAGACCTTCACTCCAGCAGCAGCAGTCAGGCAGTCCA
GAAATGAGCTACTGTGAACTGAGTCCATGCAGCCCTGCTG
ACTGGGAAAAGATGAACAGCTTACAGGCTAATGGATATGT
GGAGAGGCTAAAGACAGACGGCAGCATTAAACTAGACCGC
AGCTCCTACCACAACGCCATTGAGGCCTTAGACAACGACA
GCGAGGAAGACACCGAAGAGGATGCGGATAAAGAACAGAA
CGGCAAGAAAGCTTTCCAAAAACCTGTGTTTGAAACTGAA
TCAGCGTTCAGACCTGCAAATGTCAACTTCAGGCTGCTGC
CTAAGGAGAACAAGCCTCTGGAGATGACGGTGCTGAAGAA
AGCCAAAGAACTGCTGGTCAGTCAGGATCCAAAGACCATC
GCCAAACACATCCTGCAAGCAGACTGTCAGGTTGCCAGGA
TACTGAATGTTTCTGAGGAGGTGAAAGGTCAGATGGGTGT
GAGCTCCGGGCTGGAGCTGGTGACCCTTCCTCATGGACGA
CAGCTGAGGCTGGACCTCATAGAGAGGCATAACACTATGG
CGATCGGAGTGGCTGTGGACATCCTGGGGTGTACAGGAAG
TCTGGAGGAGCGAGCAGCCACACTAAACCGGATCATTCTG
GTGGCTCTGGAGCTCAAAGACTCCATGGGGGATCTTTATG
CCTTTTCCTCCATAATGAAAGCACTGGACATGCCTCAGAT
TACCAGACTGGATCACACATGGACTAGCTTGCGGAGGAAA
TATACACAGACTGCCATCATTTATGAGAAATCTTTAAAAC
CGTTCTACAAAGGACTCTATGAAGGAGGTGCTGAAATCCC
GCTGAGCAATGCCAGTGTTCCTCTGCTGATGCCGCTGCTC
ACCTTGATGGAGAGGCCTGCAGTCACCTTCGAGGGTATGG
ACGTCTGGGAGAACACCGATCAAGGCTGTGAAATCATGTT
TCGGCACCTGGAAGGAGCTCGAGCGGTTGCACGCAATGCA
GACACCTACACCTGCAATGCACAGCGGATCCTCCAGGACT
TCCAACCCCATGAAGACATGCTGGAGATCTTGAGGACAGA
TTTCCAGCTGCGTTTGCTCTGGGGGAGCAGAGGAGCTGCA
GTGGAGCAGACTGAGAGATACGACAAATTCAAGCTCATCC
TCACGGCCCTGTCTAGAAAACTAGAGCCTGCAGTCAAACA
CACAGAACTCTGA

bcar3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bcar3-202 (1)    Ensembl 655
bcar3-203 2693
bcar3-204 (1)    Ensembl 537
bcar3-205 (1)    Ensembl 2390
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bcar3-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000035470 (1),  Ensembl_Trans:ENSDART00000138855 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB890685 (1) 696 bp
CITATIONS (2)