Transcript

bcar3-205

ID
ZDB-TSCRIPT-090929-16089
Name
bcar3-205
Previous Names
  • bcar3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035469 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035469|OTTDARG00000026650|ZDB-GENE-080513-4 bcar3|OTTDARP00000028506 bcar3-002 LG_none CR381644.8,BX005425.12 Danio rerio protein_coding KNOWN, 2390 bp
CATGCACACACACACTTGAGCAGAGAGAGTTCACACACAC
GCATACAGACAGACGCCGGGCAGCTAACATGCTCTCATTC
ATGGCAGATAGAAGGCAGTAAGTTTTGGAGGCTGAAGCTT
GCTAGAGTGTTTTCGCTGAAACAAGAGAGATGTCTGAGAG
ATGCAATATTTTAAGGACCATCACAGCAGCTTTGTGCTGT
TTCTATCAGAAAAGCTCCGTTATTGGAGCTAAGTTCTCAA
GAGACAAGTACATCTTGGATGGACCGCCGGAGAAACTTCG
GAGGGAGTTGGAGGAAGAACTGAAACTAAGCAGTGAGGAA
CCGAGGAGCCATGCCTGGTATCACGGAGCCATTCCTAGAC
AGGTGGCTGAAAACCTGGTCCAGCGAGATGGAGATTTTCT
GATCCGGGACTCTCTGTCCAGCCCTGGCAACTACGTTCTG
ACCTGTCAGTGGAAGAACAGCCCTCAACACTTCAAAATCA
ACAAGCGGGTCGTAGCCATGAACGAGGCCTACTCACGGGT
TCAGTACCTGTTTGAGAAGGAGGGATTCGATAGCATCCCC
GCACTGGTGCGATATTACGTGGGCAACCGTGAGCCGGTCT
CTGAGGTCATCGGAGCGATTATCTTCCAGCCGATCAACAG
AGCTCTGCCTCTGAGGTGCCTGGAGGAGAAATATGGAGTG
GGATCTATACGTGTAGAGGCAGGATATCTGGAGAGAAAGA
GCCTGACGTCCAAACGGCTGAGTCTGAATATCATGAATGG
ACACGGTCAGGATCACACCCTCAGCCGTGGAAACCTCCTC
AGCAACAAGGATAAATGTGGAAGTCAACCAGCATGTCTAA
ACCACGTTCAGGAGAGGAGACGGCCGCTGAAGACCCATCA
GTCGGAGAGCTTCCTCCCTATCGGCTCCAGGCCGCAGGCT
CAGGTTCAGCATATGGAGCACCAGCCGTGCCCCAAATCTC
CGGTTTTTCGAACGGGAAGCGAGCCAGCACTGAGTCCCAC
AGTGCCACGCAGAATGGCCTTTGACACTCTGCCTGGTGAG
GCCATCCGCGGCTCTGACAGCCAGCTGTGTCCCAAACCAC
CCCCTAAACCCAGCAAGGTCCCCACAGTAAGAGTACCGTG
CATCCCAGCCCTGAAAACCCTTGTCGTCCCACCTGTCCCT
CCAGTCAAGCCCCACAAGCACAGACCTTCACTCCAGCAGC
AGCAGTCAGGCAGTCCAGAAATGAGCTACTGTGAACTGAG
TCCATGCAGCCCTGCTGACTGGGAAAAGATGAACAGCTTA
CAGGCTAATGGATATGTGGAGAGGCTAAAGACAGACGGCA
GCATTAAACTAGACCGCAGCTCCTACCACAACGCCATTGA
GGCCTTAGACAACGACAGCGAGGAAGACACCGAAGAGGAT
GCGGATAAAGAACAGAACGGCAAGAAAGCTTTCCAAAAAC
CTGTGTTTGAAACTGAATCAGCGTTCAGACCTGCAAATGT
CAACTTCAGGCTGCTGCCTAAGGAGAACAAGCCTCTGGAG
ATGACGGTGCTGAAGAAAGCCAAAGAACTGCTGGTCAGTC
AGGATCCAAAGACCATCGCCAAACACATCCTGCAAGCAGA
CTGTCAGGTTGCCAGGATACTGAATGTTTCTGAGGAGGTG
AAAGGTCAGATGGGTGTGAGCTCCGGGCTGGAGCTGGTGA
CCCTTCCTCATGGACGACAGCTGAGGCTGGACCTCATAGA
GAGGCATAACACTATGGCGATCGGAGTGGCTGTGGACATC
CTGGGGTGTACAGGAAGTCTGGAGGAGCGAGCAGCCACAC
TAAACCGGATCATTCTGGTGGCTCTGGAGCTCAAAGACTC
CATGGGGGATCTTTATGCCTTTTCCTCCATAATGAAAGCA
CTGGACATGCCTCAGATTACCAGACTGGATCACACATGGA
CTAGCTTGCGGAGGAAATATACACAGACTGCCATCATTTA
TGAGAAATCTTTAAAACCGTTCTACAAAGGACTCTATGAA
GGAGGTGCTGAAATCCCGCTGAGCAATGCCAGTGTTCCTC
TGCTGATGCCGCTGCTCACCTTGATGGAGAGGCCTGCAGT
CACCTTCGAGGGTATGGACGTCTGGGAGAACACCGATCAA
GGCTGTGAAATCATGTTTCGGCACCTGGAAGGAGCTCGAG
CGGTTGCACGCAATGCAGACACCTACACCTGCAATGCACA
GCGGATCCTCCAGGACTTCCAACCCCATGAAGACATGCTG
GAGATCTTGAGGACAGATTTCCAGCTGCGTTTGCTCTGGG
GGAGCAGAGGAGCTGCAGTGGAGCAGACTGAGAGATACGA
CAAATTCAAGCTCATCCTCACGGCCCTGTCTAGAAAACTA
GAGCCTGCAGTCAAACACACAGAACTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations