Transcript

traf1-202

ID
ZDB-TSCRIPT-090929-15692
Name
traf1-202
Previous Names
  • traf1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035005 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035005|OTTDARG00000026390|ZDB-GENE-071120-4 traf1|OTTDARP00000028170 DKEYP-51B7.2-003 LG_ CR376844.12 Danio rerio protein_coding NOVEL, 894 bp
GCTCTCTAGATTTCAAGACACAGCCACACTGTGTAAACAA
CAAGGACCTAGTGTGCACAAAATGTAAAGGAGAGGATTCC
AATGTTGAGAGTGACACTAGCGTACTGACTCCTAACCAAT
TCTTCAATGATGTGGCTATCAATAAGGAAATTTTGGATCT
GAAAGTTCACTGTGCTAACCAAGGCTGCCCCTGGAGAAGC
ACCCTAAAAAATTTTGAGGACCACCAGAGTCAGTGTGAAT
ATGCCCTGATCCCTTGTAACATTGGCTGTGGCATAATGGT
TCAGAGGAAGACACTGGCCACACATCTGGAAAGCGGCTGT
CCCAACAACAAGACCGCCTGTCCCTCCTGTACAAGTGTTC
TGACACCCAGAGAACTCCAGAAGCATGTATGTCCCAGTTC
TGGTGATAAGAAGACAGCAAAGACGGATAAAAAGCAAAAG
AATAATCAGCCGGCCAACTCAAAAAAGAAAGAACCATGCA
TTTTCTCAGACGTTGGTTGTCCTTTTAAGGGCAACCCAGA
CAAAGTAAAAGAACATGAGTCTTGCAGTCATGCGGGTCAC
CTGCAGCTTCTACTGGACGTGACCAGGGCTCTTCAGCGAA
CACTGAACTCAGCAACTGAGCGAGTCTACCAGGACAGCCC
TGTTTTTCTTGAGCCTGGACCAAATGGCTCTTCACTCGCT
CCTCAGGCTGATGGTGACATAGAAACGGATGGAGGAGATC
CGGGAGTGAGTGACAAGGCCTTCAGCCTCCACGATGATCA
GGTTGAGCTCGCCGCCGGCCAGCAGCTGGACGCCCTGCAG
CAAAAAGTGCAGGTCATAGAGAACATCATTTCCGCTCTGA
ACCGAGAGGTAGAGAAGACACAGATCAGTGTGGTGGCAAT
GAATAGAGACCATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations