Transcript

traf1-203

ID
ZDB-TSCRIPT-090929-15691
Name
traf1-203
Previous Names
  • traf1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035004 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035004|OTTDARG00000026390|ZDB-GENE-071120-4 traf1|OTTDARP00000028169 DKEYP-51B7.2-002 LG_ CR376844.12 Danio rerio protein_coding NOVEL, 884 bp
AGTATGCTCTCTAGATTTCAAGACACAGCCACACTAAACA
ACAAGGACCTAGTGTGCACAAAATGTAAAGGAGAGGATTC
CAATGTTGAGAGTGACACTAGCGTACTGACTCCTAACCAA
TTCTTCAATGATGTGGCTATCAATAAGGAAATTTTGGATC
TGAAAGTTCACTGTGCTAACCAAGGCTGCCCCTGGAGAAG
CACCCTAAAAAATTTTGAGGACCACCAGAGTCAGTGTGAA
TATGCCCTGATCCCTTGTAACATTGGCTGTGGCATAATGG
TTCAGAGGAAGACACTGGCCACACATCTGGAAAGCGGCTG
TCCCAACAACAAGACCGCCTGTCCCTCCTGTACAAGTGTT
CTGACACCCAGAGAACTCCAGAAGCATGTATGTCCCAGTT
CTGGTGATAAGAAGACAGCAAAGACGGATAAAAAGCAAAA
GAATAATCAGCCGGCCAACTCAAAAAAGAAAGAACCATGC
ATTTTCTCAGACGTTGGTTGTCCTTTTAAGGGCAACCCAG
ACAAAGTAAAAGAACATGAGTCTTGCAGTCATGCGGGTCA
CCTGCAGCTTCTACTGGACGTGACCAGGGCTCTTCAGCGA
ACACTGAACTCAGCAACTGAGCGAGTCTACCAGGACAGCC
CTGTTTTTCTTGAGCCTGGACCAAATGGCTCTTCACTCGC
TCCTCAGGCTGATGGTGACATAGAAACGGATGGAGGAGAT
CCGGGAGTGAGTGACAAGGCCTTCAGCCTCCACGATGATC
AGGTTGAGCTCGCCGCCGGCCAGCAGCTGGACGCCCTGCA
GCAAAAAGTGCAGGTCATAGAGAACATCATTTCCGCTCTG
AACCGAGAGGTAGAGAAGACACAGATCAGTGTGGTGGCAA
TGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations