ZFIN ID: ZDB-TSCRIPT-090929-15690
Transcript Name: traf1-201
Previous Name: traf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035003 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035003|OTTDARG00000026390|ZDB-GENE-071120-4 traf1|OTTDARP00000028168 DKEYP-51B7.2-001 LG_ CR376844.12 Danio rerio protein_coding NOVEL, 2220 bp
GATTGTATCGTGAACACTTCAGAGTGTAGGCGGAGTCGAG
CAATAGTGAGCACTGCACTTCTCGTTTTGTTTTTCTAGTA
TGCTCTCTAGATTTCAAGACACAGCCACACTGTGTGTAAG
CGCGTTTCTTCTACTTTCACTTATAACTCCACAAACTATC
TTTCTATTTTTATTATTTTAAGCTTTTTTCAAAATATTAT
CAGCAAGATTAGACACAGCGTGGTTGATAAACACGCGGAA
AAAGCGCAGTTTCCGGGTGTTTAAGGGGGAAACCCGTGGT
GTTTTTCGACCGTGGGTATATCACCAAAAAGTCAAAAGCA
TATCAACATGTCATCATAACGTGCTGCTGGTACAGACTCT
TCATCTTAACCCCTATAATGGCTTCTGGTTCAGCTTCAGA
CCCGTCGTTAAACGGTGTTTCGTCCACACCGGATGAGAAC
GAGTATCCGTCAGGTTTCCCTCAGAGCATCTGCGATGAGG
TGCCGAAAGATAAATACTTGTGTAGCAACTGCAATAATGT
TTTGAATAAAGCGCGTCAAACGGTGTGCGGTCACCGATAC
TGCCTCGCCTGCGTCAACTGGCTGGTCAGAAACAACAAGG
ACCTAGTGTGCACAAAATGTAAAGGAGAGGATTCCAATGT
TGAGAGTGACACTAGCGTACTGACTCCTAACCAATTCTTC
AATGATGTGGCTATCAATAAGGAAATTTTGGATCTGAAAG
TTCACTGTGCTAACCAAGGCTGCCCCTGGAGAAGCACCCT
AAAAAATTTTGAGGACCACCAGAGTCAGTGTGAATATGCC
CTGATCCCTTGTAACATTGGCTGTGGCATAATGGTTCAGA
GGAAGACACTGGCCACACATCTGGAAAGCGGCTGTCCCAA
CAACAAGACCGCCTGTCCCTCCTGTACAAGTGTTCTGACA
CCCAGAGAACTCCAGAAGCATGTATGTCCCAGTTCTGGTG
ATAAGAAGACAGCAAAGACGGATAAAAAGCAAAAGAATAA
TCAGCCGGCCAACTCAAAAAAGAAAGAACCATGCATTTTC
TCAGACGTTGGTTGTCCTTTTAAGGGCAACCCAGACAAAG
TAAAAGAACATGAGTCTTGCAGTCATGCGGGTCACCTGCA
GCTTCTACTGGACGTGACCAGGGCTCTTCAGCGAACACTG
AACTCAGCAACTGAGCGAGTCTACCAGGACAGCCCTGTTT
TTCTTGAGCCTGGACCAAATGGCTCTTCACTCGCTCCTCA
GGCTGATGGTGACATAGAAACGGATGGAGGAGATCCGGGA
GTGAGTGACAAGGCCTTCAGCCTCCACGATGATCAGGTTG
AGCTCGCCGCCGGCCAGCAGCTGGACGCCCTGCAGCAAAA
AGTGCAGGTCATAGAGAACATCATTTCCGCTCTGAACCGA
GAGGTAGAGAAGACACAGATCAGTGTGGTGGCAATGAATA
GAGACCATTGCAACAGCCAGCAGATCATTCAGCATTTGGA
AGCTACGGTAGCGGAGCTGCAGCAGAGGCTGGTCAGGAAA
GACATTCTCATCAGTTCTTTGCAGCAGTCTATCAGCGCCC
AGCAGGACGTCTCGTATGATGGCACCTTTTACTGGCGGGT
GTGTGATGTCAGCCAGAAACAGAGAGAGGCTGCCAACAGC
CAAAAGATCAGTCAGTACTCACCAGCTTTCTACACCGCCA
GGTATGGATTTAAAGTGTGTTTGCGGCTCTATTTGAACGG
AGACGGAGCTGGAAAGGGATCACACATCTCTCTTTTCTTT
GTTATAATGAAAGGAGAATATGACCCCATTCTCTCATGGC
CATTCAAACACAAGGTAACGTTCTTCCTCCTAGATCAAAA
CCAGAGGGAGCACGTCATCGATGCTTTCCGTCCCGACCTG
TCCTCCATGTCTTTCCATCAGCCTGTCAGTGATATGAATG
TGGCCAGCGGCTGCCCCCTGTTCTTCCCTCTGAAGAAACT
GAGGTCGCCCAAACATGCTTACTGCAAAGACGACACCATC
TACATTAAGTGCGTGGTGGACACCTCTTCCTGAAGCACCC
AGGTAATGGGGACGGGACACATACTGTACAAGAGCAGAAA
AAAACTGGATCTGAGGAGAACTGTAGAAGAACAAACCGCC
AAATATTCATGAGCTGAAAAGTTTCATCTTTTAGTGCATG
AATAAAATCATATTTTTTAGATTGACACCTGGCTCTTAAT
GTTTTAAACATGGATTCTTT

traf1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA traf1-201 2220
traf1-202 (1)    Ensembl 894
traf1-203 (1)    Ensembl 884
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
traf1-201 Contained in:
[BAC] DKEYP-51B7 (1)

Genome Resources: Vega_Trans:OTTDART00000035003 (1),  Ensembl_Trans:ENSDART00000101174 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH551695 (1) 994 nt
GenBank:EH996744 (1) 913 nt
GenBank:EH433737 (1) 864 nt
CITATIONS (2)