Transcript

traf1-201

ID
ZDB-TSCRIPT-090929-15690
Name
traf1-201
Previous Names
  • traf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035003 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035003|OTTDARG00000026390|ZDB-GENE-071120-4 traf1|OTTDARP00000028168 DKEYP-51B7.2-001 LG_ CR376844.12 Danio rerio protein_coding NOVEL, 2220 bp
GATTGTATCGTGAACACTTCAGAGTGTAGGCGGAGTCGAG
CAATAGTGAGCACTGCACTTCTCGTTTTGTTTTTCTAGTA
TGCTCTCTAGATTTCAAGACACAGCCACACTGTGTGTAAG
CGCGTTTCTTCTACTTTCACTTATAACTCCACAAACTATC
TTTCTATTTTTATTATTTTAAGCTTTTTTCAAAATATTAT
CAGCAAGATTAGACACAGCGTGGTTGATAAACACGCGGAA
AAAGCGCAGTTTCCGGGTGTTTAAGGGGGAAACCCGTGGT
GTTTTTCGACCGTGGGTATATCACCAAAAAGTCAAAAGCA
TATCAACATGTCATCATAACGTGCTGCTGGTACAGACTCT
TCATCTTAACCCCTATAATGGCTTCTGGTTCAGCTTCAGA
CCCGTCGTTAAACGGTGTTTCGTCCACACCGGATGAGAAC
GAGTATCCGTCAGGTTTCCCTCAGAGCATCTGCGATGAGG
TGCCGAAAGATAAATACTTGTGTAGCAACTGCAATAATGT
TTTGAATAAAGCGCGTCAAACGGTGTGCGGTCACCGATAC
TGCCTCGCCTGCGTCAACTGGCTGGTCAGAAACAACAAGG
ACCTAGTGTGCACAAAATGTAAAGGAGAGGATTCCAATGT
TGAGAGTGACACTAGCGTACTGACTCCTAACCAATTCTTC
AATGATGTGGCTATCAATAAGGAAATTTTGGATCTGAAAG
TTCACTGTGCTAACCAAGGCTGCCCCTGGAGAAGCACCCT
AAAAAATTTTGAGGACCACCAGAGTCAGTGTGAATATGCC
CTGATCCCTTGTAACATTGGCTGTGGCATAATGGTTCAGA
GGAAGACACTGGCCACACATCTGGAAAGCGGCTGTCCCAA
CAACAAGACCGCCTGTCCCTCCTGTACAAGTGTTCTGACA
CCCAGAGAACTCCAGAAGCATGTATGTCCCAGTTCTGGTG
ATAAGAAGACAGCAAAGACGGATAAAAAGCAAAAGAATAA
TCAGCCGGCCAACTCAAAAAAGAAAGAACCATGCATTTTC
TCAGACGTTGGTTGTCCTTTTAAGGGCAACCCAGACAAAG
TAAAAGAACATGAGTCTTGCAGTCATGCGGGTCACCTGCA
GCTTCTACTGGACGTGACCAGGGCTCTTCAGCGAACACTG
AACTCAGCAACTGAGCGAGTCTACCAGGACAGCCCTGTTT
TTCTTGAGCCTGGACCAAATGGCTCTTCACTCGCTCCTCA
GGCTGATGGTGACATAGAAACGGATGGAGGAGATCCGGGA
GTGAGTGACAAGGCCTTCAGCCTCCACGATGATCAGGTTG
AGCTCGCCGCCGGCCAGCAGCTGGACGCCCTGCAGCAAAA
AGTGCAGGTCATAGAGAACATCATTTCCGCTCTGAACCGA
GAGGTAGAGAAGACACAGATCAGTGTGGTGGCAATGAATA
GAGACCATTGCAACAGCCAGCAGATCATTCAGCATTTGGA
AGCTACGGTAGCGGAGCTGCAGCAGAGGCTGGTCAGGAAA
GACATTCTCATCAGTTCTTTGCAGCAGTCTATCAGCGCCC
AGCAGGACGTCTCGTATGATGGCACCTTTTACTGGCGGGT
GTGTGATGTCAGCCAGAAACAGAGAGAGGCTGCCAACAGC
CAAAAGATCAGTCAGTACTCACCAGCTTTCTACACCGCCA
GGTATGGATTTAAAGTGTGTTTGCGGCTCTATTTGAACGG
AGACGGAGCTGGAAAGGGATCACACATCTCTCTTTTCTTT
GTTATAATGAAAGGAGAATATGACCCCATTCTCTCATGGC
CATTCAAACACAAGGTAACGTTCTTCCTCCTAGATCAAAA
CCAGAGGGAGCACGTCATCGATGCTTTCCGTCCCGACCTG
TCCTCCATGTCTTTCCATCAGCCTGTCAGTGATATGAATG
TGGCCAGCGGCTGCCCCCTGTTCTTCCCTCTGAAGAAACT
GAGGTCGCCCAAACATGCTTACTGCAAAGACGACACCATC
TACATTAAGTGCGTGGTGGACACCTCTTCCTGAAGCACCC
AGGTAATGGGGACGGGACACATACTGTACAAGAGCAGAAA
AAAACTGGATCTGAGGAGAACTGTAGAAGAACAAACCGCC
AAATATTCATGAGCTGAAAAGTTTCATCTTTTAGTGCATG
AATAAAATCATATTTTTTAGATTGACACCTGGCTCTTAAT
GTTTTAAACATGGATTCTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations