Transcript

si:ch73-170l17.1-005

ID
ZDB-TSCRIPT-090929-14173
Name
si:ch73-170l17.1-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000033038 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033038|OTTDARG00000025108|ZDB-GENE-070912-331 si:ch73-170l17.1|no_translation CH73-170L17.1-005 LG_ CU179756.8 Danio rerio protein_coding NOVEL, 704 bp
GTCCAAGCACCGGCCAAGCATTTTCCTGGTTCGGGAGTGG
GTTCACAATGAGATCAGCGCCACGGAGATCCGTCGAGCTC
TGAGGAGAGGAACTTTGATGTGTAGGCTGAAGTATGAGGA
GCGCTATCCTGCTGAAGAATTTGCCCTCTCCTGTGGTTTG
TCATGTAATGTGCTGCACAAATGTCTTGATACCTCAGATT
GTTGTTGTGGCCATCCACTCTGCAGATCTCGCGCATGTCC
CCATTCTGAATGTAACCCCAAACCATGATTTTTCCTTCAC
CAAACTTGACTGATTTCTGTAAATCTTGTGTCCATGCGGG
TTCCAATAGGTCTTCTGCAGTATTTGTGATGATTGGGGTG
CAGTTCATTGGAAAAGTCTACCTTCTGCCACTTTTCCTAA
TGATCAACTAGAAGTCAAGTTAATATTTGTTGCTCTTACA
ACTGGGATTGATGACAAGACTTTTGTCAGGTAGTGTATAT
TTCCTTACTAAAAATGATTGAGGTCCAAGTGTTGTGTGAT
AAGATTATTGTGACAGGCCTAGACAGTACATAATATTTTA
CTAAATATGTTTAGATACTAGTATTCAGCTTCCATCTGTA
TACTATGGAATATAAAACTGCCTAAGAGGGCTAATAATAA
GAAGAGTATTACAGGAAATACTGTGAAAAATTCCTTGCTC
TGTTAAATTTTATTTGGGAAATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations