Transcript

nmnat3-202

ID
ZDB-TSCRIPT-090929-14169
Name
nmnat3-202
Previous Names
  • si:ch73-170l17.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000033034 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033034|OTTDARG00000025108|ZDB-GENE-070912-331 si:ch73-170l17.1|OTTDARP00000026719 CH73-170L17.1-001 LG_ CU179756.8 Danio rerio protein_coding NOVEL, 750 bp
ATGGCTGGCCGTATTCCTCTAGTTTTGCTGGCCTGTGGCT
CCTTCAACCCCATTACCCATCAGCACATGCGGCTATTTGA
GCTGGCCAGAGACCACATGCACCAGACGGGTCTGTACCGT
GTGGTGGGTGGCATTATATCTCCTGTCGGTGATGGTTATG
GTAAACAGGGTCTTGTTGCTTCAAAACACCGACTTGCTAT
GGCAAGACTGGCCTTGCAGAGCTCCGACTGGGTTTCTGTA
GATGATTGGGAAAGCCAGCAGCCAGATTGGACTGAAACTG
TGGTGACCATGAGGTACCACTACGGCCGTGTAGCTGCTCA
ACACTGCTGTAATAAGGGACCGCCCACAACCTCAGATGTT
CCTCAGTTGAAGCTGTTGTGTGGAGCTGATTTCATGGACT
CCTTTAAAGTGCCTGGTCTGTGGACGGATGAGCACATCGA
GGAGGTTGTGGGCCGATTTGGACTGGTCTGCGTGAGCCGT
GGCAGCCTTCAGCCTGATCGTGCTATACATGAGTCTGATT
TGTTGTCCAAGCACCGGCCAAGCATTTTCCTGGTTCGGGA
GTGGGTTCACAATGAGATCAGCGCCACGGAGATCCGTCGA
GCTCTGAGGAGAGGTCACAGTGTTAAATATCTGTTGCCAG
ACTCGGTCATTGAGTACATAAGAGAGCACAAGCTTTATAC
CCAAGACAGCGAGATGAAAAACAAAGACGTTAAACTACGA
CCTCTCACTAAGCAAGTGATACTAGACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations