Transcript

nmnat3-203

ID
ZDB-TSCRIPT-090929-14170
Name
nmnat3-203
Previous Names
  • si:ch73-170l17.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000033035 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033035|OTTDARG00000025108|ZDB-GENE-070912-331 si:ch73-170l17.1|OTTDARP00000026720 CH73-170L17.1-002 LG_ CU179756.8 Danio rerio protein_coding NOVEL, 823 bp
GTGTAACATACGGCTAACTATATAAGTTAGCATTTAGCAT
TTTCCTAAAATTGGAGGAGATTTTTGATAAGATATGTTGT
CTTTGTCATTCTCACAGGTCTGTACCGTGTGGTGGGTGGC
ATTATATCTCCTGTCGGTGATGGTTATGGTAAACAGGGTC
TTGTTGCTTCAAAACACCGACTTGCTATGGCAAGACTGGC
CTTGCAGAGCTCCGACTGGGTTTCTGTAGATGATTGGGAA
AGCCAGCAGCCAGATTGGACTGAAACTGTGGTGACCATGA
GGTACCACTACGGCCGTGTAGCTGCTCAACACTGCTGTAA
TAAGGGACCGCCCACAACCTCAGATGTTCCTCAGTTGAAG
CTGTTGTGTGGAGCTGATTTCATGGACTCCTTTAAAGTGC
CTGGTCTGTGGACGGATGAGCACATCGAGGAGGTTGTGGG
CCGATTTGGACTGGTCTGCGTGAGCCGTGGCAGCCTTCAG
CCTGATCGTGCTATACATGAGTCTGATTTGTTGTCCAAGC
ACCGGCCAAGCATTTTCCTGGTTCGGGAGTGGGTTCACAA
TGAGATCAGCGCCACGGAGATCCGTCGAGCTCTGAGGAGA
GGTCACAGTGTTAAATATCTGTTGCCAGACTCGGTCATTG
AGTACATAAGAGAGCACAAGCTTTATACCCAAGACAGCGA
GATGAAAAACAAAGACGTTAAACTACGACCTCTCACTAAG
CAAGTGATACTAGACTGATCTATTGGGAGGTCATAGACTT
CAGTGGTGTTGATTGCAGGAACTTTGATGTGTAGGCTGAA
GTATGAGGAGCGCTATCCTGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations