ZFIN ID: ZDB-TSCRIPT-090929-14172
Transcript Name: si:ch73-170l17.1-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033037 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033037|OTTDARG00000025108|ZDB-GENE-070912-331 si:ch73-170l17.1|no_translation CH73-170L17.1-004 LG_ CU179756.8 Danio rerio protein_coding NOVEL, 777 bp
TGTTATCCAGAGTACTATGGTGTGACACACTAAAATGGCT
GGCCGTATTCCTCTAGTTTTGCTGGCCTGTGGCTCCTTCA
ACCCCATTACCCATCAGCACATGCGGCTATTTGAGCTGGC
CAGAGACCACATGCACCAGACGGATATGTTGTCTTTGTCA
TTCTCACAGGTCTGTACCGTGTGGTGGGTGGCATTATATC
TCCTGTCGGTGATGGTTATGGTAAACAGGGTCTTGTTGCT
TCAAAACACCGACTTGCTATGGCAAGACTGGCCTTGCAGA
GCTCCGACTGGGTTTCTGTAGATGATTGGGAAAGCCAGCA
GCCAGATTGGACTGAAACTGTGGTGACCATGAGGTGAATA
TGAACAAAGAATGATTTTAGTTTTCTGCATTTACTTATTG
ATGTAAATCATTTATTCATTTAAAAACAAGAAACCTTTGG
GTGTTTTTACCACAACTGGGACTTTGACTGTGAAGGAAAC
ATCAACTGGTTTTGACAGATTCAGTACTAAATGCACCTCT
GCTATCCTAAAAACTGTTCAGAAGTTCAAAAATAGAGTGG
TTTTGATGAGAAGTTGGCTTTTTTCTACTTCAAAAGCTCT
TTTTAAATGTAAAAAGTACTGGCGGTATTAATATGAATGA
CAGTTTATGATATGCCTCACAGTTACTGTACGTCTGATGT
TGGGCTTATCTTTTCTTTAATGAACTGATGGTGCTTATTA
AAGCTTAAAAGTATTAGCAGCATAACCACTGACATTTTAA
TGTTCCCTACTGTTTCA

nmnat3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA nmnat3-202 (1)    Ensembl 750
nmnat3-203 (1)    Ensembl 823
nmnat3-204 (1)    Ensembl 195
ncRNA si:ch73-170l17.1-004 777
si:ch73-170l17.1-005 (1)    Ensembl 704
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-170l17.1-004 Contained in:
[BAC] CH73-170L17 (1)

Genome Resources: Vega_Trans:OTTDART00000033037 (1),  Ensembl_Trans:ENSDART00000146406 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO249909 (1) 807 nt
CITATIONS (2)